Incidental Mutation 'R1624:Chd9'
ID174891
Institutional Source Beutler Lab
Gene Symbol Chd9
Ensembl Gene ENSMUSG00000056608
Gene Namechromodomain helicase DNA binding protein 9
Synonyms1810014J18Rik, AD013, 9030205D12Rik, A330063D19Rik
MMRRC Submission 039661-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R1624 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location90828352-91054516 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90998535 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 691 (Y691F)
Ref Sequence ENSEMBL: ENSMUSP00000147741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048665] [ENSMUST00000109614] [ENSMUST00000209203] [ENSMUST00000209423] [ENSMUST00000210947]
Predicted Effect unknown
Transcript: ENSMUST00000048665
AA Change: Y1164F
SMART Domains Protein: ENSMUSP00000046356
Gene: ENSMUSG00000056608
AA Change: Y1164F

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2456 2505 6.77e-25 SMART
BRK 2530 2574 1.5e-17 SMART
low complexity region 2594 2608 N/A INTRINSIC
low complexity region 2609 2639 N/A INTRINSIC
low complexity region 2642 2659 N/A INTRINSIC
low complexity region 2690 2704 N/A INTRINSIC
low complexity region 2746 2771 N/A INTRINSIC
low complexity region 2802 2813 N/A INTRINSIC
low complexity region 2843 2869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000109614
AA Change: Y1164F
SMART Domains Protein: ENSMUSP00000105243
Gene: ENSMUSG00000056608
AA Change: Y1164F

DomainStartEndE-ValueType
low complexity region 323 334 N/A INTRINSIC
low complexity region 586 605 N/A INTRINSIC
CHROMO 687 753 2.41e-10 SMART
CHROMO 770 828 4.35e-8 SMART
DEXDc 855 1056 3.8e-36 SMART
Blast:DEXDc 1149 1174 7e-6 BLAST
HELICc 1211 1295 2.86e-22 SMART
low complexity region 1462 1475 N/A INTRINSIC
Blast:DEXDc 1506 1551 3e-16 BLAST
low complexity region 2048 2067 N/A INTRINSIC
low complexity region 2127 2199 N/A INTRINSIC
BRK 2472 2521 6.77e-25 SMART
BRK 2546 2590 1.5e-17 SMART
low complexity region 2610 2624 N/A INTRINSIC
low complexity region 2625 2655 N/A INTRINSIC
low complexity region 2658 2675 N/A INTRINSIC
low complexity region 2706 2720 N/A INTRINSIC
low complexity region 2762 2787 N/A INTRINSIC
low complexity region 2818 2829 N/A INTRINSIC
low complexity region 2859 2885 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209203
AA Change: Y1164F

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect unknown
Transcript: ENSMUST00000209423
AA Change: Y1164F
Predicted Effect probably benign
Transcript: ENSMUST00000210947
AA Change: Y691F

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211552
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 99% (90/91)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik T C 16: 21,653,746 Y68C probably damaging Het
6820408C15Rik A T 2: 152,434,111 H81L probably damaging Het
Acbd4 A G 11: 103,103,959 T48A probably damaging Het
Acpp T A 9: 104,320,001 E146D probably benign Het
Acsm1 T A 7: 119,652,573 I307N probably damaging Het
Adcy4 T C 14: 55,781,927 T89A possibly damaging Het
Agl T C 3: 116,787,246 T356A probably benign Het
Ago1 A G 4: 126,463,741 I47T probably damaging Het
Akr1c6 T A 13: 4,446,364 Y75N probably benign Het
Anxa2 T A 9: 69,479,708 S92T probably benign Het
Arid4b T C 13: 14,184,394 S585P probably damaging Het
Arl4d T C 11: 101,667,016 S123P possibly damaging Het
Atad2 A T 15: 58,100,019 D1067E probably damaging Het
Brap C A 5: 121,682,859 T403K possibly damaging Het
Brwd1 A T 16: 96,008,144 N1895K possibly damaging Het
Ccdc187 T C 2: 26,281,075 T464A probably benign Het
Cdh11 T C 8: 102,664,601 probably benign Het
Clhc1 A T 11: 29,569,287 I365F possibly damaging Het
Col11a1 A G 3: 114,158,155 Q1078R probably damaging Het
Creb3 G A 4: 43,566,375 V294I possibly damaging Het
Cspg4 T C 9: 56,888,470 I1163T probably damaging Het
Cyp3a57 A C 5: 145,390,415 probably null Het
Dnah3 A T 7: 120,019,695 I1661N probably damaging Het
Dpysl4 A C 7: 139,089,553 D49A probably damaging Het
Efhb T A 17: 53,426,278 I522F probably damaging Het
Epha4 T C 1: 77,399,692 T517A probably damaging Het
Fasn A G 11: 120,813,111 S1466P probably damaging Het
Fgd6 A T 10: 94,137,436 D1253V probably benign Het
Fjx1 G A 2: 102,451,164 A142V probably benign Het
Foxb1 T C 9: 69,759,316 T311A probably benign Het
Fpgs A G 2: 32,691,188 probably null Het
Gm10024 A G 10: 77,711,772 probably null Het
Gnat3 A T 5: 18,003,843 T182S possibly damaging Het
Igsf3 T A 3: 101,455,227 F875I probably benign Het
Kif13b A G 14: 64,738,619 E461G probably damaging Het
Kif23 A T 9: 61,925,700 probably null Het
Kntc1 G A 5: 123,758,477 R134Q possibly damaging Het
Krt33a A T 11: 100,014,246 Y145N probably damaging Het
Lama5 A G 2: 180,206,758 V313A probably benign Het
Lamb1 T C 12: 31,278,652 probably null Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mtor C T 4: 148,547,676 L2336F probably damaging Het
Naglu T C 11: 101,076,525 S434P probably damaging Het
Ncoa7 T A 10: 30,704,659 H101L possibly damaging Het
Nlrc4 G A 17: 74,445,189 T733I possibly damaging Het
Nr3c2 A G 8: 76,909,944 E558G probably damaging Het
Nsun4 A T 4: 116,034,200 N327K probably benign Het
Olfr1310 T A 2: 112,008,532 Y218F probably damaging Het
Olfr165 T A 16: 19,407,704 Y104F probably benign Het
Olfr524 T C 7: 140,201,951 N273S probably damaging Het
Olfr54 T C 11: 51,027,125 V41A probably damaging Het
Olfr743 A G 14: 50,533,643 Y77C probably damaging Het
Pdia2 T A 17: 26,196,521 I441F probably damaging Het
Phyh T C 2: 4,925,683 S74P probably benign Het
Pigo A G 4: 43,024,661 L146P probably damaging Het
Plce1 A G 19: 38,724,775 D1191G probably damaging Het
Plrg1 T C 3: 83,067,994 probably benign Het
Plrg1 G A 3: 83,069,744 R364Q probably damaging Het
Polr3b T C 10: 84,679,805 L614S probably damaging Het
Pramef25 A T 4: 143,949,830 C235S possibly damaging Het
Prrg4 A G 2: 104,832,682 V193A probably damaging Het
Prss16 T A 13: 22,003,313 E47V probably benign Het
Ptpru G A 4: 131,772,550 T1261I probably damaging Het
Pycard A G 7: 127,992,798 S124P possibly damaging Het
Riok1 C A 13: 38,037,511 D17E probably damaging Het
Scin T A 12: 40,127,930 Y102F probably benign Het
Scmh1 A G 4: 120,529,228 H655R probably damaging Het
Scyl2 A T 10: 89,640,736 N842K probably benign Het
Sec23b T A 2: 144,567,129 M211K probably benign Het
Serpina3i A C 12: 104,268,638 *409C probably null Het
Sgk2 G A 2: 162,997,859 R129H probably benign Het
Slc39a13 A G 2: 91,068,526 I80T probably damaging Het
Smarcad1 A G 6: 65,052,647 D73G probably benign Het
Spata18 A C 5: 73,669,545 T276P probably damaging Het
Srgap1 T G 10: 121,855,373 M319L probably benign Het
Stx7 T A 10: 24,185,005 V210E probably damaging Het
Tjp2 T A 19: 24,131,412 H112L probably benign Het
Tuba8 A T 6: 121,220,426 I16F probably damaging Het
Ube3c G A 5: 29,646,619 A815T probably benign Het
Vmn2r5 A T 3: 64,509,695 V14E probably benign Het
Vmn2r79 A T 7: 87,004,039 probably null Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zdbf2 A G 1: 63,303,859 T466A possibly damaging Het
Other mutations in Chd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Chd9 APN 8 91025392 missense possibly damaging 0.79
IGL00547:Chd9 APN 8 91005798 missense probably damaging 1.00
IGL00589:Chd9 APN 8 91015846 missense probably damaging 1.00
IGL00640:Chd9 APN 8 90986132 missense probably damaging 0.99
IGL00663:Chd9 APN 8 90983490 missense probably damaging 1.00
IGL00852:Chd9 APN 8 90973207 missense probably benign 0.29
IGL00908:Chd9 APN 8 90996880 missense probably damaging 1.00
IGL00911:Chd9 APN 8 91051692 missense probably damaging 1.00
IGL01068:Chd9 APN 8 91042116 missense probably benign 0.13
IGL01668:Chd9 APN 8 91026776 missense possibly damaging 0.53
IGL01873:Chd9 APN 8 90933767 missense probably benign 0.00
IGL01969:Chd9 APN 8 91033510 missense possibly damaging 0.72
IGL02105:Chd9 APN 8 90932488 missense probably damaging 1.00
IGL02153:Chd9 APN 8 90956494 nonsense probably null
IGL02164:Chd9 APN 8 90933221 missense possibly damaging 0.94
IGL02725:Chd9 APN 8 91051684 missense possibly damaging 0.78
IGL02755:Chd9 APN 8 91033582 missense probably benign 0.33
IGL02892:Chd9 APN 8 90976915 splice site probably benign
IGL02897:Chd9 APN 8 90933868 splice site probably benign
IGL03005:Chd9 APN 8 91011447 missense probably damaging 0.98
IGL03062:Chd9 APN 8 91015267 splice site probably benign
IGL03140:Chd9 APN 8 91042228 missense possibly damaging 0.91
R0056:Chd9 UTSW 8 90933537 missense possibly damaging 0.62
R0157:Chd9 UTSW 8 91008836 splice site probably null
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0238:Chd9 UTSW 8 90932828 missense probably damaging 1.00
R0432:Chd9 UTSW 8 90994450 splice site probably benign
R0454:Chd9 UTSW 8 90973231 missense possibly damaging 0.83
R0573:Chd9 UTSW 8 90998595 missense probably damaging 1.00
R0580:Chd9 UTSW 8 90994563 missense possibly damaging 0.91
R0604:Chd9 UTSW 8 91036542 missense possibly damaging 0.82
R0662:Chd9 UTSW 8 90977676 missense probably damaging 0.99
R0825:Chd9 UTSW 8 91051197 missense probably benign 0.06
R0945:Chd9 UTSW 8 90933002 missense possibly damaging 0.60
R0964:Chd9 UTSW 8 91015204 missense probably benign 0.19
R0967:Chd9 UTSW 8 90989479 missense probably damaging 1.00
R1015:Chd9 UTSW 8 90932578 missense probably damaging 0.99
R1066:Chd9 UTSW 8 90986136 nonsense probably null
R1244:Chd9 UTSW 8 91022929 missense probably damaging 0.99
R1505:Chd9 UTSW 8 91006495 intron probably null
R1570:Chd9 UTSW 8 91036542 missense probably benign 0.03
R1591:Chd9 UTSW 8 90983538 missense probably damaging 0.97
R1626:Chd9 UTSW 8 90994596 missense probably benign 0.00
R1632:Chd9 UTSW 8 90956707 nonsense probably null
R1649:Chd9 UTSW 8 90932601 missense possibly damaging 0.88
R1664:Chd9 UTSW 8 91022790 intron probably null
R1668:Chd9 UTSW 8 91041186 missense probably damaging 0.99
R1681:Chd9 UTSW 8 90973135 missense probably damaging 0.98
R1695:Chd9 UTSW 8 91001782 missense probably damaging 1.00
R1714:Chd9 UTSW 8 91034225 utr 3 prime probably benign
R1746:Chd9 UTSW 8 91010698 missense probably benign 0.01
R1843:Chd9 UTSW 8 91010794 missense probably benign 0.19
R1844:Chd9 UTSW 8 90956695 nonsense probably null
R1941:Chd9 UTSW 8 90977069 critical splice donor site probably null
R2022:Chd9 UTSW 8 91035054 missense probably benign 0.17
R2027:Chd9 UTSW 8 90907991 unclassified probably benign
R2098:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2099:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2100:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2101:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2224:Chd9 UTSW 8 91011285 missense probably benign 0.04
R2276:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2278:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2316:Chd9 UTSW 8 91051128 missense probably damaging 0.99
R2507:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2508:Chd9 UTSW 8 91033987 missense probably benign 0.01
R2988:Chd9 UTSW 8 91030460 intron probably null
R3418:Chd9 UTSW 8 91036591 missense probably damaging 1.00
R3817:Chd9 UTSW 8 90984265 splice site probably benign
R3923:Chd9 UTSW 8 90933519 missense probably benign 0.16
R4001:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4003:Chd9 UTSW 8 90956557 missense probably damaging 1.00
R4006:Chd9 UTSW 8 90933560 missense probably benign 0.12
R4013:Chd9 UTSW 8 90973169 missense possibly damaging 0.82
R4067:Chd9 UTSW 8 91023574 missense possibly damaging 0.53
R4108:Chd9 UTSW 8 91010676 missense probably benign 0.04
R4125:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4126:Chd9 UTSW 8 91051284 missense probably damaging 0.99
R4452:Chd9 UTSW 8 90977680 missense probably damaging 0.99
R4463:Chd9 UTSW 8 90978999 missense probably benign 0.01
R4478:Chd9 UTSW 8 91034031 utr 3 prime probably benign
R4587:Chd9 UTSW 8 91036506 missense possibly damaging 0.95
R4628:Chd9 UTSW 8 90983463 missense probably benign 0.05
R4667:Chd9 UTSW 8 91033800 missense possibly damaging 0.73
R4908:Chd9 UTSW 8 91015249 missense possibly damaging 0.50
R4912:Chd9 UTSW 8 91034230 missense possibly damaging 0.84
R4977:Chd9 UTSW 8 91033708 missense possibly damaging 0.96
R5016:Chd9 UTSW 8 91006626 nonsense probably null
R5083:Chd9 UTSW 8 90984374 missense probably damaging 1.00
R5088:Chd9 UTSW 8 90977519 missense possibly damaging 0.94
R5090:Chd9 UTSW 8 91026834 nonsense probably null
R5307:Chd9 UTSW 8 90997149 missense probably damaging 1.00
R5541:Chd9 UTSW 8 91051504 missense probably benign 0.09
R5559:Chd9 UTSW 8 91015925 critical splice donor site probably null
R5638:Chd9 UTSW 8 91011450 missense possibly damaging 0.67
R5640:Chd9 UTSW 8 91036562 missense probably damaging 1.00
R5793:Chd9 UTSW 8 91001756 missense probably damaging 1.00
R5827:Chd9 UTSW 8 90989450 missense probably damaging 1.00
R5834:Chd9 UTSW 8 90997164 missense probably damaging 1.00
R5875:Chd9 UTSW 8 91051836 missense probably damaging 0.99
R6002:Chd9 UTSW 8 90978887 missense probably damaging 1.00
R6091:Chd9 UTSW 8 91035063 missense probably damaging 1.00
R6185:Chd9 UTSW 8 91049137 missense probably damaging 1.00
R6246:Chd9 UTSW 8 90932417 missense probably damaging 1.00
R6292:Chd9 UTSW 8 90932922 missense probably benign 0.05
R6305:Chd9 UTSW 8 91030546 missense possibly damaging 0.93
R6348:Chd9 UTSW 8 91011275 missense possibly damaging 0.95
R6438:Chd9 UTSW 8 90998521 missense probably benign 0.02
R6470:Chd9 UTSW 8 90932798 missense probably damaging 1.00
R6798:Chd9 UTSW 8 91051554 missense possibly damaging 0.56
R6902:Chd9 UTSW 8 91042951 missense probably damaging 1.00
R6908:Chd9 UTSW 8 90956416 missense probably benign 0.02
R6929:Chd9 UTSW 8 91042945 missense probably damaging 1.00
R6969:Chd9 UTSW 8 90978914 missense probably benign 0.34
X0065:Chd9 UTSW 8 91036572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGACAAGGAGTTCTGTTGCCC -3'
(R):5'- AACCACACAGTGTGCCTCTGTACC -3'

Sequencing Primer
(F):5'- TTCCTAGAAGCACTCATTAGCAG -3'
(R):5'- CTCTTATGGATAAGGTAGTCTTCCAG -3'
Posted On2014-04-24