Mutagenetix > Incidental Mutation

Incidental Mutation 'R1625:Rif1'

174940

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

D2Ertd145e, 6530403D07Rik, 5730435J01Rik

MMRRC Submission

039662-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1625 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

51962844-52012395 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 51993652 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 855 (I855T)

Ref Sequence

ENSEMBL: ENSMUSP00000108313 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069794
AA Change: I855T

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: I855T

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112693
AA Change: I855T

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: I855T

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.3%
20x: 89.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	T	A	11: 109,857,947 (GRCm39)	M605L	probably benign	Het
Abcc5	A	T	16: 20,184,567 (GRCm39)	S1031T	probably damaging	Het
Acot7	T	A	4: 152,270,748 (GRCm39)	C31S	probably benign	Het
Acss3	A	T	10: 106,773,263 (GRCm39)		probably null	Het
Adipor1	T	C	1: 134,351,802 (GRCm39)	F83S	possibly damaging	Het
Agrn	G	A	4: 156,257,317 (GRCm39)	S1171L	probably damaging	Het
Aoc1l1	T	A	6: 48,952,105 (GRCm39)	L10Q	probably damaging	Het
Arhgap5	T	A	12: 52,564,159 (GRCm39)	C377S	probably benign	Het
Arid4b	T	A	13: 14,361,699 (GRCm39)	V721D	probably damaging	Het
Aspm	G	A	1: 139,408,777 (GRCm39)	A2555T	probably benign	Het
Atp6v0a1	T	A	11: 100,946,380 (GRCm39)	L791Q	probably damaging	Het
Car11	A	G	7: 45,350,731 (GRCm39)	K76E	probably benign	Het
Casp8ap2	T	A	4: 32,648,068 (GRCm39)	M1925K	probably benign	Het
Cc2d1a	A	T	8: 84,866,001 (GRCm39)	L418Q	probably damaging	Het
Ccl9	G	A	11: 83,466,736 (GRCm39)	R64W	probably damaging	Het
Cfap20dc	A	G	14: 8,431,668 (GRCm38)	Y655H	probably damaging	Het
Cfap43	T	A	19: 47,739,527 (GRCm39)	K1325N	probably damaging	Het
Dars2	G	A	1: 160,881,614 (GRCm39)	P305L	possibly damaging	Het
Ddx11	C	T	17: 66,457,692 (GRCm39)	T859I	probably benign	Het
Dock7	C	T	4: 98,850,433 (GRCm39)		probably null	Het
Efcab6	A	G	15: 83,831,839 (GRCm39)	V570A	probably benign	Het
Fermt1	T	A	2: 132,764,751 (GRCm39)	I369F	probably damaging	Het
Fras1	A	G	5: 96,861,849 (GRCm39)	Y2161C	probably damaging	Het
Fras1	C	A	5: 96,857,837 (GRCm39)	P2044T	possibly damaging	Het
Gucy1a1	T	C	3: 82,009,362 (GRCm39)	I549V	probably benign	Het
Hspg2	G	A	4: 137,246,282 (GRCm39)	S1020N	probably benign	Het
Kif21a	A	G	15: 90,826,378 (GRCm39)	S1360P	probably damaging	Het
Lrp3	T	C	7: 34,903,350 (GRCm39)	Y332C	probably damaging	Het
Ltc4s	C	A	11: 50,128,215 (GRCm39)	A32S	possibly damaging	Het
Mgrn1	T	C	16: 4,728,627 (GRCm39)	L84P	probably damaging	Het
Muc2	C	G	7: 141,283,405 (GRCm39)	C672W	probably damaging	Het
Mvp	A	T	7: 126,600,845 (GRCm39)	V52E	probably damaging	Het
Ndrg2	T	C	14: 52,144,420 (GRCm39)	T269A	probably damaging	Het
Notch2	T	A	3: 98,018,891 (GRCm39)	D684E	probably damaging	Het
Nup205	A	G	6: 35,168,878 (GRCm39)	D316G	probably benign	Het
Or12e7	T	A	2: 87,288,016 (GRCm39)	I169K	probably damaging	Het
Or2v2	T	C	11: 49,004,071 (GRCm39)	M161V	probably benign	Het
Or7d11	A	G	9: 19,966,678 (GRCm39)	L27P	probably damaging	Het
Pcsk1	A	T	13: 75,274,971 (GRCm39)	D520V	probably benign	Het
Pik3cg	A	T	12: 32,244,741 (GRCm39)	D904E	probably damaging	Het
Pitpnm2	T	A	5: 124,271,496 (GRCm39)	D359V	probably benign	Het
Ppih	T	C	4: 119,175,779 (GRCm39)	I69V	probably damaging	Het
Rab11fip3	T	C	17: 26,287,865 (GRCm39)	E96G	possibly damaging	Het
Retreg3	C	A	11: 100,992,875 (GRCm39)	M1I	probably null	Het
Rfpl4	C	T	7: 5,118,409 (GRCm39)	V54I	possibly damaging	Het
Rrm1	T	A	7: 102,117,554 (GRCm39)	I748N	probably damaging	Het
Sap130	T	A	18: 31,807,517 (GRCm39)	N441K	probably damaging	Het
Sf3b1	T	A	1: 55,058,536 (GRCm39)	I18F	probably damaging	Het
Skor2	A	G	18: 76,946,499 (GRCm39)	N74D	unknown	Het
Slc17a6	C	A	7: 51,311,208 (GRCm39)	F307L	probably benign	Het
Slc25a13	G	A	6: 6,096,675 (GRCm39)	L410F	probably damaging	Het
Slc47a1	A	T	11: 61,262,625 (GRCm39)	V38E	probably damaging	Het
Slc8a1	T	A	17: 81,956,670 (GRCm39)	T123S	probably damaging	Het
Slc9a5	C	A	8: 106,094,755 (GRCm39)	T782K	possibly damaging	Het
Spmip7	C	A	11: 11,438,644 (GRCm39)		probably benign	Het
Sppl2c	C	A	11: 104,077,995 (GRCm39)	T265K	probably damaging	Het
Srfbp1	A	G	18: 52,621,788 (GRCm39)	K283R	probably benign	Het
Ssr1	C	T	13: 38,173,479 (GRCm39)		probably null	Het
Stard3nl	T	C	13: 19,556,754 (GRCm39)		probably null	Het
Timeless	G	T	10: 128,076,493 (GRCm39)	S134I	probably damaging	Het
Tll1	A	G	8: 64,494,476 (GRCm39)	F760L	probably damaging	Het
Tspear	A	G	10: 77,706,333 (GRCm39)	I368V	probably benign	Het
Txnrd2	G	T	16: 18,257,116 (GRCm39)	W144L	probably damaging	Het
Unc5d	T	C	8: 29,173,234 (GRCm39)	E668G	probably damaging	Het
Urb1	C	T	16: 90,570,936 (GRCm39)		probably null	Het
Uts2r	A	G	11: 121,052,033 (GRCm39)	Y299C	probably damaging	Het
Vmn1r66	G	T	7: 10,008,316 (GRCm39)	T239K	probably benign	Het
Vps39	C	T	2: 120,154,106 (GRCm39)	V630M	probably damaging	Het
Wrn	T	C	8: 33,819,158 (GRCm39)	T22A	probably benign	Het
Zfp7	T	A	15: 76,765,374 (GRCm39)	D22E	probably damaging	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52,011,019 (GRCm39)	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52,001,082 (GRCm39)	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52,009,129 (GRCm39)	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	51,975,152 (GRCm39)	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	51,985,960 (GRCm39)	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52,001,315 (GRCm39)	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52,001,534 (GRCm39)	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52,002,555 (GRCm39)	missense	probably benign	0.07
IGL02441:Rif1	APN	2	51,995,527 (GRCm39)	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52,006,708 (GRCm39)	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	51,967,077 (GRCm39)	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	51,983,588 (GRCm39)	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52,000,137 (GRCm39)	nonsense	probably null
IGL03060:Rif1	APN	2	52,002,149 (GRCm39)	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	51,993,634 (GRCm39)	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	51,980,273 (GRCm39)	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	51,967,000 (GRCm39)	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52,002,611 (GRCm39)	missense	probably benign	0.32
hifi	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
nietzsche	UTSW	2	51,967,032 (GRCm39)	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52,001,970 (GRCm39)	missense
R0017:Rif1	UTSW	2	52,006,686 (GRCm39)	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52,006,686 (GRCm39)	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52,001,129 (GRCm39)	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52,001,129 (GRCm39)	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52,000,104 (GRCm39)	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	51,980,298 (GRCm39)	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0278:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0288:Rif1	UTSW	2	52,000,025 (GRCm39)	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0345:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0346:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0383:Rif1	UTSW	2	51,975,153 (GRCm39)	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0387:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0388:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0456:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0477:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0505:Rif1	UTSW	2	52,000,749 (GRCm39)	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0511:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0512:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0633:Rif1	UTSW	2	52,002,575 (GRCm39)	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0638:Rif1	UTSW	2	52,001,600 (GRCm39)	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0675:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0707:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0726:Rif1	UTSW	2	52,000,365 (GRCm39)	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0744:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0938:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0939:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0940:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0941:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0942:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R0943:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1006:Rif1	UTSW	2	51,975,041 (GRCm39)	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52,001,574 (GRCm39)	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1175:Rif1	UTSW	2	51,997,640 (GRCm39)	unclassified	probably benign
R1183:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1184:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1271:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1332:Rif1	UTSW	2	51,968,326 (GRCm39)	missense	probably benign	0.06
R1336:Rif1	UTSW	2	51,968,326 (GRCm39)	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52,001,567 (GRCm39)	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1527:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1560:Rif1	UTSW	2	52,001,143 (GRCm39)	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	51,963,235 (GRCm39)	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1679:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1689:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1731:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1744:Rif1	UTSW	2	52,002,404 (GRCm39)	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1748:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R1831:Rif1	UTSW	2	51,968,507 (GRCm39)	nonsense	probably null
R1902:Rif1	UTSW	2	52,006,685 (GRCm39)	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	51,988,421 (GRCm39)	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2000:Rif1	UTSW	2	51,971,310 (GRCm39)	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	51,982,358 (GRCm39)	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	51,983,588 (GRCm39)	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2109:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2125:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2126:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2145:Rif1	UTSW	2	52,001,412 (GRCm39)	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2153:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2213:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2327:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2512:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2513:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2516:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2520:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R2905:Rif1	UTSW	2	51,988,516 (GRCm39)	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	51,972,776 (GRCm39)	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R3156:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R3429:Rif1	UTSW	2	52,000,336 (GRCm39)	unclassified	probably benign
R3707:Rif1	UTSW	2	51,983,592 (GRCm39)	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52,002,557 (GRCm39)	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52,006,759 (GRCm39)	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52,011,099 (GRCm39)	missense	probably benign	0.01
R4052:Rif1	UTSW	2	51,988,483 (GRCm39)	nonsense	probably null
R4668:Rif1	UTSW	2	52,001,964 (GRCm39)	missense	probably benign	0.01
R4674:Rif1	UTSW	2	51,996,954 (GRCm39)	missense	probably null	1.00
R4715:Rif1	UTSW	2	51,963,151 (GRCm39)	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	51,988,946 (GRCm39)	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52,002,759 (GRCm39)	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52,002,759 (GRCm39)	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	51,983,623 (GRCm39)	intron	probably benign
R4911:Rif1	UTSW	2	52,000,530 (GRCm39)	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	51,974,998 (GRCm39)	splice site	probably null
R5044:Rif1	UTSW	2	51,999,940 (GRCm39)	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	51,982,307 (GRCm39)	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52,010,321 (GRCm39)	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	51,971,301 (GRCm39)	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	51,967,032 (GRCm39)	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52,001,836 (GRCm39)	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52,010,983 (GRCm39)	intron	probably benign
R5476:Rif1	UTSW	2	51,979,607 (GRCm39)	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	51,988,928 (GRCm39)	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52,011,170 (GRCm39)	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	51,995,651 (GRCm39)	critical splice donor site	probably null
R5987:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	51,985,856 (GRCm39)	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	51,975,065 (GRCm39)	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52,009,168 (GRCm39)	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	51,997,681 (GRCm39)	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	51,968,275 (GRCm39)	splice site	probably null
R6928:Rif1	UTSW	2	51,985,973 (GRCm39)	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52,002,703 (GRCm39)	missense	probably benign	0.00
R7003:Rif1	UTSW	2	51,967,001 (GRCm39)	missense	probably benign	0.06
R7310:Rif1	UTSW	2	51,995,631 (GRCm39)	missense	probably benign	0.12
R7549:Rif1	UTSW	2	51,968,519 (GRCm39)	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	51,966,187 (GRCm39)	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	51,978,666 (GRCm39)	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	51,975,153 (GRCm39)	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52,006,368 (GRCm39)	missense	probably benign	0.00
R7910:Rif1	UTSW	2	51,968,399 (GRCm39)	nonsense	probably null
R7962:Rif1	UTSW	2	51,964,288 (GRCm39)	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	51,980,290 (GRCm39)	missense	noncoding transcript
R8390:Rif1	UTSW	2	52,000,935 (GRCm39)	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52,002,563 (GRCm39)	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52,001,011 (GRCm39)	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52,001,742 (GRCm39)	missense
R8785:Rif1	UTSW	2	52,000,493 (GRCm39)	missense	probably benign	0.06
R8890:Rif1	UTSW	2	51,988,875 (GRCm39)	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52,000,989 (GRCm39)	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52,001,862 (GRCm39)	missense	probably benign	0.22
R9284:Rif1	UTSW	2	51,998,564 (GRCm39)	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52,001,151 (GRCm39)	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52,010,356 (GRCm39)	missense
R9477:Rif1	UTSW	2	52,001,342 (GRCm39)	missense	probably benign	0.02
R9522:Rif1	UTSW	2	51,971,311 (GRCm39)	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52,000,466 (GRCm39)	missense	probably benign	0.29
R9630:Rif1	UTSW	2	51,979,607 (GRCm39)	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	51,984,645 (GRCm39)	missense	probably damaging	0.96
X0064:Rif1	UTSW	2	51,964,327 (GRCm39)	missense	probably benign	0.00
Z1177:Rif1	UTSW	2	51,978,660 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCCAATTATGTCTTAGCACCGCAG -3'
(R):5'- AGCTCCAAGTTAGCAAGAAGCCTG -3'

Sequencing Primer
(F):5'- GATCTTCAGATTGGTCCAGAAAG -3'
(R):5'- ggaggcaaaggcagattcag -3'

Posted On

2014-04-24