Incidental Mutation 'R1625:Hspg2'
ID174951
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Nameperlecan (heparan sulfate proteoglycan 2)
SynonymsPlc, Pcn, per
MMRRC Submission 039662-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1625 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137468769-137570630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 137518971 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 1020 (S1020N)
Ref Sequence ENSEMBL: ENSMUSP00000030547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
Predicted Effect probably benign
Transcript: ENSMUST00000030547
AA Change: S1020N

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: S1020N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171332
AA Change: S1020N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: S1020N

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,431,668 Y655H probably damaging Het
Abca8b T A 11: 109,967,121 M605L probably benign Het
Abcc5 A T 16: 20,365,817 S1031T probably damaging Het
Acot7 T A 4: 152,186,291 C31S probably benign Het
Acss3 A T 10: 106,937,402 probably null Het
Adipor1 T C 1: 134,424,064 F83S possibly damaging Het
Agrn G A 4: 156,172,860 S1171L probably damaging Het
Arhgap5 T A 12: 52,517,376 C377S probably benign Het
Arid4b T A 13: 14,187,114 V721D probably damaging Het
Aspm G A 1: 139,481,039 A2555T probably benign Het
Atp6v0a1 T A 11: 101,055,554 L791Q probably damaging Het
Car11 A G 7: 45,701,307 K76E probably benign Het
Casp8ap2 T A 4: 32,648,068 M1925K probably benign Het
Cc2d1a A T 8: 84,139,372 L418Q probably damaging Het
Ccl9 G A 11: 83,575,910 R64W probably damaging Het
Cfap43 T A 19: 47,751,088 K1325N probably damaging Het
Dars2 G A 1: 161,054,044 P305L possibly damaging Het
Ddx11 C T 17: 66,150,697 T859I probably benign Het
Dock7 C T 4: 98,962,196 probably null Het
Doxl2 T A 6: 48,975,171 L10Q probably damaging Het
Efcab6 A G 15: 83,947,638 V570A probably benign Het
Fermt1 T A 2: 132,922,831 I369F probably damaging Het
Fras1 C A 5: 96,709,978 P2044T possibly damaging Het
Fras1 A G 5: 96,713,990 Y2161C probably damaging Het
Gucy1a1 T C 3: 82,102,055 I549V probably benign Het
Kif21a A G 15: 90,942,175 S1360P probably damaging Het
Lrp3 T C 7: 35,203,925 Y332C probably damaging Het
Ltc4s C A 11: 50,237,388 A32S possibly damaging Het
Mgrn1 T C 16: 4,910,763 L84P probably damaging Het
Muc2 C G 7: 141,697,162 C672W probably damaging Het
Mvp A T 7: 127,001,673 V52E probably damaging Het
Ndrg2 T C 14: 51,906,963 T269A probably damaging Het
Notch2 T A 3: 98,111,575 D684E probably damaging Het
Nup205 A G 6: 35,191,943 D316G probably benign Het
Olfr1126 T A 2: 87,457,672 I169K probably damaging Het
Olfr1396 T C 11: 49,113,244 M161V probably benign Het
Olfr867 A G 9: 20,055,382 L27P probably damaging Het
Pcsk1 A T 13: 75,126,852 D520V probably benign Het
Pik3cg A T 12: 32,194,742 D904E probably damaging Het
Pitpnm2 T A 5: 124,133,433 D359V probably benign Het
Ppih T C 4: 119,318,582 I69V probably damaging Het
Rab11fip3 T C 17: 26,068,891 E96G possibly damaging Het
Retreg3 C A 11: 101,102,049 M1I probably null Het
Rfpl4 C T 7: 5,115,410 V54I possibly damaging Het
Rif1 T C 2: 52,103,640 I855T probably benign Het
Rrm1 T A 7: 102,468,347 I748N probably damaging Het
Sap130 T A 18: 31,674,464 N441K probably damaging Het
Sf3b1 T A 1: 55,019,377 I18F probably damaging Het
Skor2 A G 18: 76,858,804 N74D unknown Het
Slc17a6 C A 7: 51,661,460 F307L probably benign Het
Slc25a13 G A 6: 6,096,675 L410F probably damaging Het
Slc47a1 A T 11: 61,371,799 V38E probably damaging Het
Slc8a1 T A 17: 81,649,241 T123S probably damaging Het
Slc9a5 C A 8: 105,368,123 T782K possibly damaging Het
Spata48 C A 11: 11,488,644 probably benign Het
Sppl2c C A 11: 104,187,169 T265K probably damaging Het
Srfbp1 A G 18: 52,488,716 K283R probably benign Het
Ssr1 C T 13: 37,989,503 probably null Het
Stard3nl T C 13: 19,372,584 probably null Het
Timeless G T 10: 128,240,624 S134I probably damaging Het
Tll1 A G 8: 64,041,442 F760L probably damaging Het
Tspear A G 10: 77,870,499 I368V probably benign Het
Txnrd2 G T 16: 18,438,366 W144L probably damaging Het
Unc5d T C 8: 28,683,206 E668G probably damaging Het
Urb1 C T 16: 90,774,048 probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vmn1r66 G T 7: 10,274,389 T239K probably benign Het
Vps39 C T 2: 120,323,625 V630M probably damaging Het
Wrn T C 8: 33,329,130 T22A probably benign Het
Zfp7 T A 15: 76,881,174 D22E probably damaging Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137528820 missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137539195 missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137562201 missense probably benign 0.15
IGL00970:Hspg2 APN 4 137542590 missense probably benign 0.09
IGL01011:Hspg2 APN 4 137559335 missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137546658 missense probably benign 0.11
IGL01333:Hspg2 APN 4 137540314 missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137538489 missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137553817 missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137519706 missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137539183 missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137552803 missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137514773 missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137564926 missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137512671 missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137561926 missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137540073 missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137552254 missense probably benign
IGL02051:Hspg2 APN 4 137568389 unclassified probably benign
IGL02124:Hspg2 APN 4 137518814 splice site probably null
IGL02128:Hspg2 APN 4 137564016 missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137515316 missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137518645 missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137510577 missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137508389 missense probably benign 0.03
IGL02477:Hspg2 APN 4 137544512 splice site probably benign
IGL02514:Hspg2 APN 4 137569576 missense probably benign 0.09
IGL02613:Hspg2 APN 4 137544420 missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137512642 missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137551848 missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137557445 splice site probably benign
IGL02701:Hspg2 APN 4 137557174 missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137555130 missense probably benign 0.00
IGL02985:Hspg2 APN 4 137507803 missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137561825 critical splice donor site probably null
IGL03181:Hspg2 APN 4 137515937 missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137560522 splice site probably benign
PIT4305001:Hspg2 UTSW 4 137550373 missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137519931 missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137542849 missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137562201 missense probably benign 0.15
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137551887 missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137511158 missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137515423 missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137533529 missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137550024 missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137502294 missense probably benign
R0599:Hspg2 UTSW 4 137512401 missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137514722 missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137553280 missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137512349 missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137541440 missense probably benign 0.00
R1403:Hspg2 UTSW 4 137540100 missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137517636 missense probably benign
R1497:Hspg2 UTSW 4 137548096 missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137511241 splice site probably benign
R1630:Hspg2 UTSW 4 137518435 missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137533437 nonsense probably null
R1699:Hspg2 UTSW 4 137548012 splice site probably null
R1703:Hspg2 UTSW 4 137559151 missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137514673 missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137520156 missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137518509 missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137545567 missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137565490 missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1931:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137542552 missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137564895 missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137568366 missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137559367 missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137520109 missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137517604 missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137522043 missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137549574 missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137555290 missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137565504 splice site probably benign
R3873:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137539349 missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137559314 missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137515568 missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137556657 missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137468911 missense probably benign 0.17
R4355:Hspg2 UTSW 4 137529418 missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4411:Hspg2 UTSW 4 137562224 missense probably benign
R4421:Hspg2 UTSW 4 137548122 missense probably benign 0.01
R4592:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137539575 missense possibly damaging 0.80
R4619:Hspg2 UTSW 4 137546573 missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137533730 missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137539645 missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137522127 missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137570073 unclassified probably benign
R4793:Hspg2 UTSW 4 137529473 missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137565395 missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137541666 missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137542530 missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137508031 missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137518940 missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137540230 missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137511926 missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137543914 missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137528794 splice site probably null
R5529:Hspg2 UTSW 4 137551828 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137520551 missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137542825 missense probably benign 0.17
R5546:Hspg2 UTSW 4 137548174 critical splice donor site probably null
R5728:Hspg2 UTSW 4 137542766 missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137561721 missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137553782 missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137518772 missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137540735 missense probably benign
R6164:Hspg2 UTSW 4 137514655 missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137569518 missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137540248 missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137519686 missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137544705 missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137561955 missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137541695 missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137539396 missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137507801 missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137555275 missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137565737 missense probably benign 0.18
R6724:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137551803 missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137508398 missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137515307 missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137540720 missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137519289 missense probably benign 0.45
R6968:Hspg2 UTSW 4 137535156 missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137528890 missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137542269 missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137544366 missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137510652 missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137552116 missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137514719 missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137533561 critical splice donor site probably null
R7238:Hspg2 UTSW 4 137508393 missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137519946 missense probably benign 0.15
R7278:Hspg2 UTSW 4 137551125 missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137529556 missense probably benign 0.00
R7390:Hspg2 UTSW 4 137539179 missense probably damaging 1.00
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137533738 missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137550391 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAACATTCTCCATCTCCAGGTGCTC -3'
(R):5'- ACGCTTGCTGTAAGGGAAGTGAC -3'

Sequencing Primer
(F):5'- TCAGTTCAGCCTGAGCAACG -3'
(R):5'- GTGACATGAGATCCATTCCTGAC -3'
Posted On2014-04-24