Incidental Mutation 'R1228:Sp110'
ID175020
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 039297-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R1228 (G1)
Quality Score84
Status Not validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85591760 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 116 (P116S)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
AA Change: P116S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: P116S

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152399
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T A 4: 57,856,909 I787N probably damaging Het
Bag6 T A 17: 35,145,333 S863R probably damaging Het
Ccdc181 C T 1: 164,286,391 R455* probably null Het
Clvs2 T C 10: 33,622,604 N110S probably benign Het
Enpp1 T A 10: 24,645,412 I806F probably benign Het
Fam189a2 A G 19: 23,979,465 S355P probably benign Het
Fli1 T C 9: 32,423,843 Y431C probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Klhl25 C T 7: 75,866,120 A258V probably benign Het
Krt13 T C 11: 100,121,477 S7G probably benign Het
Pappa T C 4: 65,340,689 F1558S probably damaging Het
Phc3 A T 3: 30,922,255 N721K possibly damaging Het
Plxna4 A T 6: 32,224,152 probably null Het
Rabac1 T C 7: 24,972,098 probably null Het
Rims1 T C 1: 22,472,756 D572G probably null Het
Rpia T C 6: 70,791,896 N85S probably benign Het
Sh3gl3 A G 7: 82,174,975 M1V probably null Het
Skint6 T C 4: 112,854,452 N956S probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Spata7 T C 12: 98,634,269 L47P probably damaging Het
Tcea2 G T 2: 181,684,445 V81F probably benign Het
Ttbk1 A T 17: 46,476,712 probably null Het
Vmn2r77 G A 7: 86,801,034 probably null Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTTCCTGAATGCAGCCAAGGAGAG -3'
(R):5'- CACAAATGGATGCGTGTGGTGATG -3'

Sequencing Primer
(F):5'- AAGGACTGGGCTGCTCATC -3'
(R):5'- TGATGAGCCTGTTCTGTGC -3'
Posted On2014-04-24