Incidental Mutation 'R1313:Ints1'
ID175054
Institutional Source Beutler Lab
Gene Symbol Ints1
Ensembl Gene ENSMUSG00000029547
Gene Nameintegrator complex subunit 1
Synonyms1110015K06Rik
MMRRC Submission 039379-MU
Accession Numbers

Genbank: NM_026748; MGI: 1915760

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1313 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location139751282-139775674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139762906 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1049 (T1049A)
Ref Sequence ENSEMBL: ENSMUSP00000143789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072607] [ENSMUST00000200393]
Predicted Effect probably benign
Transcript: ENSMUST00000072607
AA Change: T1047A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072406
Gene: ENSMUSG00000029547
AA Change: T1047A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200339
Predicted Effect probably benign
Transcript: ENSMUST00000200393
AA Change: T1049A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143789
Gene: ENSMUSG00000029547
AA Change: T1049A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS1 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(9)

Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,265,672 T226A probably benign Het
Ankle1 A G 8: 71,407,213 E145G possibly damaging Het
C1qtnf12 G A 4: 155,965,874 E223K probably damaging Het
Cep250 C T 2: 155,972,079 A589V probably damaging Het
Clhc1 A G 11: 29,571,678 I404V probably benign Het
Ddi1 T C 9: 6,265,769 E200G probably damaging Het
Dmxl1 T C 18: 49,878,483 S1236P probably damaging Het
Dpyd G T 3: 118,899,161 probably benign Het
Ercc6 C T 14: 32,552,720 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hnrnpul1 G T 7: 25,722,916 probably benign Het
Lilrb4 C T 10: 51,480,736 T6I probably benign Het
Mocs1 A T 17: 49,454,269 T464S probably benign Het
Myo15b T C 11: 115,885,129 S816P probably damaging Het
Ogfr T C 2: 180,594,630 L336P probably benign Het
Olfr473 A T 7: 107,933,768 M83L probably benign Het
Pet112l A G 3: 85,653,826 I550V probably benign Het
Psapl1 C A 5: 36,205,266 Q401K probably benign Het
Rps26-ps1 T A 8: 107,439,457 probably benign Het
Sh3rf3 C A 10: 59,071,999 Q450K possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Stat1 C T 1: 52,156,006 T720I probably damaging Het
Vav1 G A 17: 57,309,498 probably benign Het
Other mutations in Ints1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ints1 APN 5 139771682 missense probably damaging 0.99
IGL01329:Ints1 APN 5 139767503 splice site probably benign
IGL01414:Ints1 APN 5 139758498 missense probably benign
IGL01612:Ints1 APN 5 139756292 missense probably benign 0.17
IGL01726:Ints1 APN 5 139768411 splice site probably benign
IGL01958:Ints1 APN 5 139760088 missense possibly damaging 0.94
IGL02122:Ints1 APN 5 139765150 nonsense probably null
IGL02149:Ints1 APN 5 139751960 missense probably damaging 1.00
IGL02349:Ints1 APN 5 139768468 missense probably damaging 0.96
IGL02557:Ints1 APN 5 139771637 missense probably damaging 1.00
IGL02814:Ints1 APN 5 139772391 missense possibly damaging 0.80
IGL02815:Ints1 APN 5 139755282 missense probably damaging 0.96
IGL02825:Ints1 APN 5 139764739 missense probably benign 0.32
IGL03000:Ints1 APN 5 139766506 missense probably benign 0.01
IGL03164:Ints1 APN 5 139752735 missense probably damaging 0.99
A9681:Ints1 UTSW 5 139770139 missense possibly damaging 0.56
R0113:Ints1 UTSW 5 139765213 missense probably benign 0.01
R0193:Ints1 UTSW 5 139751730 missense probably damaging 1.00
R0372:Ints1 UTSW 5 139772438 missense probably damaging 1.00
R1129:Ints1 UTSW 5 139758471 missense probably benign 0.00
R1290:Ints1 UTSW 5 139771410 nonsense probably null
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1691:Ints1 UTSW 5 139768932 missense probably damaging 1.00
R1708:Ints1 UTSW 5 139762839 missense probably damaging 1.00
R1791:Ints1 UTSW 5 139774522 missense probably benign 0.04
R2066:Ints1 UTSW 5 139767496 missense probably benign 0.14
R2102:Ints1 UTSW 5 139755999 missense possibly damaging 0.50
R2108:Ints1 UTSW 5 139767750 missense probably damaging 1.00
R2238:Ints1 UTSW 5 139765200 missense possibly damaging 0.95
R2426:Ints1 UTSW 5 139771814 critical splice donor site probably null
R2913:Ints1 UTSW 5 139757913 missense possibly damaging 0.91
R3896:Ints1 UTSW 5 139757644 nonsense probably null
R4608:Ints1 UTSW 5 139759844 missense probably benign 0.13
R4658:Ints1 UTSW 5 139774299 missense possibly damaging 0.88
R4797:Ints1 UTSW 5 139771876 missense possibly damaging 0.85
R4887:Ints1 UTSW 5 139771156 missense possibly damaging 0.66
R4944:Ints1 UTSW 5 139758092 splice site probably null
R4956:Ints1 UTSW 5 139757130 missense probably damaging 1.00
R4976:Ints1 UTSW 5 139752811 missense probably damaging 1.00
R5283:Ints1 UTSW 5 139764382 missense probably damaging 1.00
R5354:Ints1 UTSW 5 139766428 critical splice donor site probably null
R5496:Ints1 UTSW 5 139755198 missense probably benign 0.07
R5517:Ints1 UTSW 5 139752787 missense possibly damaging 0.86
R5696:Ints1 UTSW 5 139754989 missense probably benign 0.00
R5766:Ints1 UTSW 5 139772145 missense probably benign 0.33
R6359:Ints1 UTSW 5 139756217 missense probably benign 0.09
R6753:Ints1 UTSW 5 139765175 missense probably damaging 1.00
R6892:Ints1 UTSW 5 139767828 missense probably damaging 0.99
R7009:Ints1 UTSW 5 139768462 missense possibly damaging 0.83
R7047:Ints1 UTSW 5 139758471 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCACAACATTGGTGACACAGC -3'
(R):5'- AGTCTTGCGTCTAAGGGTAGACTGG -3'

Sequencing Primer
(F):5'- ATTGGTGACACAGCCATCTG -3'
(R):5'- TGTCACTTGTGCTGTCAGAG -3'
Posted On2014-04-24