Incidental Mutation 'R1564:Mnd1'
ID175091
Institutional Source Beutler Lab
Gene Symbol Mnd1
Ensembl Gene ENSMUSG00000033752
Gene Namemeiotic nuclear divisions 1
Synonyms2610034E18Rik
MMRRC Submission 039603-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1564 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location84087933-84155786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84116431 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 116 (E116G)
Ref Sequence ENSEMBL: ENSMUSP00000048262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047368]
Predicted Effect probably benign
Transcript: ENSMUST00000047368
AA Change: E116G

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048262
Gene: ENSMUSG00000033752
AA Change: E116G

DomainStartEndE-ValueType
Pfam:Penicillinase_R 10 129 6.9e-8 PFAM
Pfam:Mnd1 16 202 1.7e-76 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of the MND1 gene associates with HOP2 (MIM 608665) to form a stable heterodimeric complex that binds DNA and stimulates the recombinase activity of RAD51 (MIM 179617) and DMC1 (MIM 602721) (Chi et al., 2007 [PubMed 17639080]). Both the MND1 and HOP2 genes are indispensable for meiotic recombination.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants for this allele display defects in homologous chromosome synapsis and double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik T C 13: 19,729,300 noncoding transcript Het
Abca13 C T 11: 9,434,316 Q3923* probably null Het
Abcc12 T A 8: 86,517,486 T1013S probably benign Het
Acad9 T C 3: 36,089,429 I558T possibly damaging Het
Agbl4 C A 4: 110,955,564 probably null Het
Akr1b3 C T 6: 34,306,535 probably null Het
Aktip A G 8: 91,131,081 M1T probably null Het
Apc G T 18: 34,315,149 Q1665H probably benign Het
Arfgef3 T C 10: 18,591,704 D1916G probably damaging Het
Arhgef11 T C 3: 87,702,510 V365A probably benign Het
Bank1 C A 3: 136,213,841 E265* probably null Het
Bbs7 A T 3: 36,575,795 D578E probably damaging Het
Bin3 T C 14: 70,134,769 F172L probably damaging Het
Bves A G 10: 45,369,281 D350G probably benign Het
Cacna1h A T 17: 25,377,861 C80* probably null Het
Cacna2d4 T C 6: 119,241,195 F164L possibly damaging Het
Cenpj T C 14: 56,552,066 D842G probably benign Het
Col12a1 C A 9: 79,613,840 R2781L probably damaging Het
Cyp2c68 A T 19: 39,735,580 C213* probably null Het
Defb33 T A 8: 20,897,581 C45S possibly damaging Het
Dolk A T 2: 30,285,621 N137K probably damaging Het
Fam171b G A 2: 83,880,284 E767K probably damaging Het
Fbxl20 A T 11: 98,098,486 D189E probably damaging Het
Gm10643 A T 8: 84,064,482 M1K probably null Het
Gm572 T G 4: 148,651,186 I24S possibly damaging Het
Gnpda1 A G 18: 38,338,089 probably null Het
Helz2 G T 2: 181,233,228 N1824K probably benign Het
Insl3 G T 8: 71,690,291 A99S possibly damaging Het
Lpin2 G A 17: 71,225,060 V137I probably benign Het
Lrrc9 A G 12: 72,487,053 E1032G probably damaging Het
Macf1 T C 4: 123,459,357 T1510A probably benign Het
Mycbp2 A G 14: 103,169,851 probably null Het
Myoz3 G A 18: 60,580,842 S23L probably benign Het
Napsa G T 7: 44,586,649 V371F probably damaging Het
Nefh T C 11: 4,939,878 T914A unknown Het
Neurod2 A T 11: 98,327,424 C305S probably damaging Het
Nmnat3 T C 9: 98,354,166 probably null Het
Nuf2 A G 1: 169,498,793 V463A unknown Het
Olfml1 A T 7: 107,571,139 T78S possibly damaging Het
Olfr1199 A T 2: 88,756,656 N6K possibly damaging Het
Olfr1228 G T 2: 89,249,672 N7K probably benign Het
Olfr61 G A 7: 140,638,054 V118I probably benign Het
Olfr800 T C 10: 129,660,015 F70L probably benign Het
Opcml G A 9: 28,903,316 C288Y probably damaging Het
Oprl1 T C 2: 181,718,940 I222T possibly damaging Het
Pcsk5 A G 19: 17,654,756 Y349H probably damaging Het
Pla2g4d C A 2: 120,268,903 R706L possibly damaging Het
Pmm1 A G 15: 81,956,200 Y55H probably damaging Het
Polb A G 8: 22,630,341 probably null Het
Pom121l2 T C 13: 21,983,353 I598T possibly damaging Het
Pxmp2 C T 5: 110,281,196 probably null Het
Rbm39 G T 2: 156,154,257 L403I probably benign Het
Rec8 T C 14: 55,622,275 probably null Het
Reck T C 4: 43,912,061 I190T probably benign Het
Rer1 A T 4: 155,075,593 I166N probably damaging Het
Rgs17 T A 10: 5,842,567 K60* probably null Het
Ripor2 C T 13: 24,675,785 T152M probably damaging Het
Scgb1b2 A T 7: 31,291,775 probably benign Het
Scn3a C A 2: 65,514,635 R503M probably damaging Het
Scn4a C A 11: 106,345,541 D298Y probably benign Het
Scn9a A G 2: 66,484,304 F1679S probably damaging Het
Scyl3 G T 1: 163,939,984 probably null Het
Sec23ip A G 7: 128,766,281 probably null Het
She C T 3: 89,849,614 A325V possibly damaging Het
Skint2 T G 4: 112,625,998 M200R probably damaging Het
Slc17a5 A T 9: 78,578,699 C35S probably damaging Het
Slc25a24 T A 3: 109,163,503 S393T probably damaging Het
Slc6a19 C T 13: 73,686,124 V320M probably damaging Het
Snap91 T C 9: 86,792,196 D579G possibly damaging Het
Spats2l C T 1: 57,946,224 R479C probably damaging Het
Syngr3 G C 17: 24,686,668 probably null Het
Tas2r107 A C 6: 131,659,822 I88R probably damaging Het
Them7 A T 2: 105,297,914 N80I probably damaging Het
Tmprss7 C T 16: 45,662,153 probably null Het
Tnrc6b A G 15: 80,880,168 N624D possibly damaging Het
Trpm2 T G 10: 77,942,999 I378L probably benign Het
Ttn C A 2: 76,724,532 W30676L probably damaging Het
Ttn A G 2: 76,944,040 V2220A unknown Het
Uba6 T C 5: 86,154,407 T134A probably benign Het
Vmn2r55 A G 7: 12,684,751 S81P probably damaging Het
Zfp616 T A 11: 74,084,722 S606T probably damaging Het
Zfp653 C A 9: 22,055,859 A577S probably damaging Het
Other mutations in Mnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Mnd1 APN 3 84138198 missense possibly damaging 0.95
IGL01355:Mnd1 APN 3 84116477 missense probably benign 0.00
IGL02413:Mnd1 APN 3 84116479 missense probably benign
IGL03303:Mnd1 APN 3 84104937 missense probably benign 0.00
trinidad UTSW 3 84134109 missense probably benign 0.30
R0569:Mnd1 UTSW 3 84104979 missense probably benign 0.36
R2208:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2211:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2964:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R2965:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R3106:Mnd1 UTSW 3 84134109 missense probably benign 0.30
R5496:Mnd1 UTSW 3 84088174 missense probably damaging 1.00
R6319:Mnd1 UTSW 3 84141764 missense possibly damaging 0.95
X0026:Mnd1 UTSW 3 84093558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAGGAAGCAATGGAGGAAAGGA -3'
(R):5'- GCTAAGCCAACAGTCTGTTTCATTTTGTC -3'

Sequencing Primer
(F):5'- tccacacaataacccaatgaaac -3'
(R):5'- CTTCTAAAGGGATCTTCTAGGCAGC -3'
Posted On2014-04-24