Incidental Mutation 'R1564:Skint2'
Institutional Source Beutler Lab
Gene Symbol Skint2
Ensembl Gene ENSMUSG00000034359
Gene Nameselection and upkeep of intraepithelial T cells 2
SynonymsB7S3, OTTMUSG00000008540
MMRRC Submission 039603-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1564 (G1)
Quality Score225
Status Not validated
Chromosomal Location112557194-112652248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 112625998 bp
Amino Acid Change Methionine to Arginine at position 200 (M200R)
Ref Sequence ENSEMBL: ENSMUSP00000139831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058791] [ENSMUST00000106560] [ENSMUST00000186969]
Predicted Effect probably damaging
Transcript: ENSMUST00000058791
AA Change: M200R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061011
Gene: ENSMUSG00000034359
AA Change: M200R

IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 140 225 2.7e-10 PFAM
Pfam:Ig_2 153 231 3.6e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106559
SMART Domains Protein: ENSMUSP00000102169
Gene: ENSMUSG00000034359

signal peptide 1 21 N/A INTRINSIC
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 146 225 5.2e-8 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106560
AA Change: M200R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102170
Gene: ENSMUSG00000034359
AA Change: M200R

IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 1.3e-10 PFAM
Pfam:Ig_2 153 231 2e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186969
AA Change: M200R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139831
Gene: ENSMUSG00000034359
AA Change: M200R

signal peptide 1 21 N/A INTRINSIC
IGv 41 122 2.52e-9 SMART
Pfam:C2-set_2 145 225 2e-10 PFAM
Pfam:Ig_2 154 231 1.7e-3 PFAM
transmembrane domain 241 263 N/A INTRINSIC
transmembrane domain 276 298 N/A INTRINSIC
transmembrane domain 322 344 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik T C 13: 19,729,300 noncoding transcript Het
Abca13 C T 11: 9,434,316 Q3923* probably null Het
Abcc12 T A 8: 86,517,486 T1013S probably benign Het
Acad9 T C 3: 36,089,429 I558T possibly damaging Het
Agbl4 C A 4: 110,955,564 probably null Het
Akr1b3 C T 6: 34,306,535 probably null Het
Aktip A G 8: 91,131,081 M1T probably null Het
Apc G T 18: 34,315,149 Q1665H probably benign Het
Arfgef3 T C 10: 18,591,704 D1916G probably damaging Het
Arhgef11 T C 3: 87,702,510 V365A probably benign Het
Bank1 C A 3: 136,213,841 E265* probably null Het
Bbs7 A T 3: 36,575,795 D578E probably damaging Het
Bin3 T C 14: 70,134,769 F172L probably damaging Het
Bves A G 10: 45,369,281 D350G probably benign Het
Cacna1h A T 17: 25,377,861 C80* probably null Het
Cacna2d4 T C 6: 119,241,195 F164L possibly damaging Het
Cenpj T C 14: 56,552,066 D842G probably benign Het
Col12a1 C A 9: 79,613,840 R2781L probably damaging Het
Cyp2c68 A T 19: 39,735,580 C213* probably null Het
Defb33 T A 8: 20,897,581 C45S possibly damaging Het
Dolk A T 2: 30,285,621 N137K probably damaging Het
Fam171b G A 2: 83,880,284 E767K probably damaging Het
Fbxl20 A T 11: 98,098,486 D189E probably damaging Het
Gm10643 A T 8: 84,064,482 M1K probably null Het
Gm572 T G 4: 148,651,186 I24S possibly damaging Het
Gnpda1 A G 18: 38,338,089 probably null Het
Helz2 G T 2: 181,233,228 N1824K probably benign Het
Insl3 G T 8: 71,690,291 A99S possibly damaging Het
Lpin2 G A 17: 71,225,060 V137I probably benign Het
Lrrc9 A G 12: 72,487,053 E1032G probably damaging Het
Macf1 T C 4: 123,459,357 T1510A probably benign Het
Mnd1 T C 3: 84,116,431 E116G probably benign Het
Mycbp2 A G 14: 103,169,851 probably null Het
Myoz3 G A 18: 60,580,842 S23L probably benign Het
Napsa G T 7: 44,586,649 V371F probably damaging Het
Nefh T C 11: 4,939,878 T914A unknown Het
Neurod2 A T 11: 98,327,424 C305S probably damaging Het
Nmnat3 T C 9: 98,354,166 probably null Het
Nuf2 A G 1: 169,498,793 V463A unknown Het
Olfml1 A T 7: 107,571,139 T78S possibly damaging Het
Olfr1199 A T 2: 88,756,656 N6K possibly damaging Het
Olfr1228 G T 2: 89,249,672 N7K probably benign Het
Olfr61 G A 7: 140,638,054 V118I probably benign Het
Olfr800 T C 10: 129,660,015 F70L probably benign Het
Opcml G A 9: 28,903,316 C288Y probably damaging Het
Oprl1 T C 2: 181,718,940 I222T possibly damaging Het
Pcsk5 A G 19: 17,654,756 Y349H probably damaging Het
Pla2g4d C A 2: 120,268,903 R706L possibly damaging Het
Pmm1 A G 15: 81,956,200 Y55H probably damaging Het
Polb A G 8: 22,630,341 probably null Het
Pom121l2 T C 13: 21,983,353 I598T possibly damaging Het
Pxmp2 C T 5: 110,281,196 probably null Het
Rbm39 G T 2: 156,154,257 L403I probably benign Het
Rec8 T C 14: 55,622,275 probably null Het
Reck T C 4: 43,912,061 I190T probably benign Het
Rer1 A T 4: 155,075,593 I166N probably damaging Het
Rgs17 T A 10: 5,842,567 K60* probably null Het
Ripor2 C T 13: 24,675,785 T152M probably damaging Het
Scgb1b2 A T 7: 31,291,775 probably benign Het
Scn3a C A 2: 65,514,635 R503M probably damaging Het
Scn4a C A 11: 106,345,541 D298Y probably benign Het
Scn9a A G 2: 66,484,304 F1679S probably damaging Het
Scyl3 G T 1: 163,939,984 probably null Het
Sec23ip A G 7: 128,766,281 probably null Het
She C T 3: 89,849,614 A325V possibly damaging Het
Slc17a5 A T 9: 78,578,699 C35S probably damaging Het
Slc25a24 T A 3: 109,163,503 S393T probably damaging Het
Slc6a19 C T 13: 73,686,124 V320M probably damaging Het
Snap91 T C 9: 86,792,196 D579G possibly damaging Het
Spats2l C T 1: 57,946,224 R479C probably damaging Het
Syngr3 G C 17: 24,686,668 probably null Het
Tas2r107 A C 6: 131,659,822 I88R probably damaging Het
Them7 A T 2: 105,297,914 N80I probably damaging Het
Tmprss7 C T 16: 45,662,153 probably null Het
Tnrc6b A G 15: 80,880,168 N624D possibly damaging Het
Trpm2 T G 10: 77,942,999 I378L probably benign Het
Ttn C A 2: 76,724,532 W30676L probably damaging Het
Ttn A G 2: 76,944,040 V2220A unknown Het
Uba6 T C 5: 86,154,407 T134A probably benign Het
Vmn2r55 A G 7: 12,684,751 S81P probably damaging Het
Zfp616 T A 11: 74,084,722 S606T probably damaging Het
Zfp653 C A 9: 22,055,859 A577S probably damaging Het
Other mutations in Skint2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Skint2 APN 4 112624212 missense probably damaging 1.00
IGL00801:Skint2 APN 4 112625991 missense possibly damaging 0.88
IGL01602:Skint2 APN 4 112625994 missense probably benign 0.44
IGL01605:Skint2 APN 4 112625994 missense probably benign 0.44
IGL02015:Skint2 APN 4 112624128 nonsense probably null
IGL02694:Skint2 APN 4 112616595 splice site probably benign
IGL03247:Skint2 APN 4 112626026 missense probably benign 0.06
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0054:Skint2 UTSW 4 112645463 missense probably benign 0.15
R0190:Skint2 UTSW 4 112616532 missense possibly damaging 0.85
R0479:Skint2 UTSW 4 112624041 missense possibly damaging 0.47
R0625:Skint2 UTSW 4 112624086 missense probably damaging 1.00
R1143:Skint2 UTSW 4 112625936 missense probably benign 0.00
R1861:Skint2 UTSW 4 112647118 intron probably benign
R1864:Skint2 UTSW 4 112625909 missense probably benign 0.10
R3079:Skint2 UTSW 4 112639673 missense probably benign 0.01
R3891:Skint2 UTSW 4 112624186 missense probably damaging 1.00
R4422:Skint2 UTSW 4 112584588 intron probably benign
R4799:Skint2 UTSW 4 112652108 missense probably benign 0.07
R5458:Skint2 UTSW 4 112624180 missense possibly damaging 0.83
R5482:Skint2 UTSW 4 112625879 missense probably damaging 1.00
R5603:Skint2 UTSW 4 112649764 missense possibly damaging 0.91
R7068:Skint2 UTSW 4 112624351 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgagaaacacatagagaaaaagcc -3'
Posted On2014-04-24