Incidental Mutation 'R1564:Napsa'
ID175111
Institutional Source Beutler Lab
Gene Symbol Napsa
Ensembl Gene ENSMUSG00000002204
Gene Namenapsin A aspartic peptidase
SynonymsKdap, NAP1, napsin, pronapsin
MMRRC Submission 039603-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.361) question?
Stock #R1564 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44572380-44586862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44586649 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 371 (V371F)
Ref Sequence ENSEMBL: ENSMUSP00000002274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002274] [ENSMUST00000107906] [ENSMUST00000107907] [ENSMUST00000207493] [ENSMUST00000208514] [ENSMUST00000208651] [ENSMUST00000209177]
Predicted Effect probably damaging
Transcript: ENSMUST00000002274
AA Change: V371F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002274
Gene: ENSMUSG00000002204
AA Change: V371F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Asp 72 396 6.6e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107906
SMART Domains Protein: ENSMUSP00000103539
Gene: ENSMUSG00000062785

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 21 8e-9 PFAM
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 290 551 4.1e-45 PFAM
Pfam:Ion_trans_2 451 544 8.2e-12 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 730 746 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107907
SMART Domains Protein: ENSMUSP00000103540
Gene: ENSMUSG00000062785

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
BTB 90 194 4.38e-12 SMART
low complexity region 211 243 N/A INTRINSIC
low complexity region 251 267 N/A INTRINSIC
Pfam:Ion_trans 351 539 1.5e-31 PFAM
Pfam:Ion_trans_2 450 544 2.4e-11 PFAM
low complexity region 578 605 N/A INTRINSIC
low complexity region 622 650 N/A INTRINSIC
low complexity region 729 745 N/A INTRINSIC
low complexity region 749 766 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207302
Predicted Effect probably benign
Transcript: ENSMUST00000207493
Predicted Effect probably benign
Transcript: ENSMUST00000208514
Predicted Effect probably benign
Transcript: ENSMUST00000208651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209101
Predicted Effect probably benign
Transcript: ENSMUST00000209177
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein is proteolytically processed to generate an activation peptide and the mature protease. The activation peptides of aspartic proteinases function as inhibitors of the protease active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The encoded protease may play a role in the proteolytic processing of pulmonary surfactant protein B in the lung and may function in protein catabolism in the renal proximal tubules. This gene has been described as a marker for lung adenocarcinoma and renal cell carcinoma. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik T C 13: 19,729,300 noncoding transcript Het
Abca13 C T 11: 9,434,316 Q3923* probably null Het
Abcc12 T A 8: 86,517,486 T1013S probably benign Het
Acad9 T C 3: 36,089,429 I558T possibly damaging Het
Agbl4 C A 4: 110,955,564 probably null Het
Akr1b3 C T 6: 34,306,535 probably null Het
Aktip A G 8: 91,131,081 M1T probably null Het
Apc G T 18: 34,315,149 Q1665H probably benign Het
Arfgef3 T C 10: 18,591,704 D1916G probably damaging Het
Arhgef11 T C 3: 87,702,510 V365A probably benign Het
Bank1 C A 3: 136,213,841 E265* probably null Het
Bbs7 A T 3: 36,575,795 D578E probably damaging Het
Bin3 T C 14: 70,134,769 F172L probably damaging Het
Bves A G 10: 45,369,281 D350G probably benign Het
Cacna1h A T 17: 25,377,861 C80* probably null Het
Cacna2d4 T C 6: 119,241,195 F164L possibly damaging Het
Cenpj T C 14: 56,552,066 D842G probably benign Het
Col12a1 C A 9: 79,613,840 R2781L probably damaging Het
Cyp2c68 A T 19: 39,735,580 C213* probably null Het
Defb33 T A 8: 20,897,581 C45S possibly damaging Het
Dolk A T 2: 30,285,621 N137K probably damaging Het
Fam171b G A 2: 83,880,284 E767K probably damaging Het
Fbxl20 A T 11: 98,098,486 D189E probably damaging Het
Gm10643 A T 8: 84,064,482 M1K probably null Het
Gm572 T G 4: 148,651,186 I24S possibly damaging Het
Gnpda1 A G 18: 38,338,089 probably null Het
Helz2 G T 2: 181,233,228 N1824K probably benign Het
Insl3 G T 8: 71,690,291 A99S possibly damaging Het
Lpin2 G A 17: 71,225,060 V137I probably benign Het
Lrrc9 A G 12: 72,487,053 E1032G probably damaging Het
Macf1 T C 4: 123,459,357 T1510A probably benign Het
Mnd1 T C 3: 84,116,431 E116G probably benign Het
Mycbp2 A G 14: 103,169,851 probably null Het
Myoz3 G A 18: 60,580,842 S23L probably benign Het
Nefh T C 11: 4,939,878 T914A unknown Het
Neurod2 A T 11: 98,327,424 C305S probably damaging Het
Nmnat3 T C 9: 98,354,166 probably null Het
Nuf2 A G 1: 169,498,793 V463A unknown Het
Olfml1 A T 7: 107,571,139 T78S possibly damaging Het
Olfr1199 A T 2: 88,756,656 N6K possibly damaging Het
Olfr1228 G T 2: 89,249,672 N7K probably benign Het
Olfr61 G A 7: 140,638,054 V118I probably benign Het
Olfr800 T C 10: 129,660,015 F70L probably benign Het
Opcml G A 9: 28,903,316 C288Y probably damaging Het
Oprl1 T C 2: 181,718,940 I222T possibly damaging Het
Pcsk5 A G 19: 17,654,756 Y349H probably damaging Het
Pla2g4d C A 2: 120,268,903 R706L possibly damaging Het
Pmm1 A G 15: 81,956,200 Y55H probably damaging Het
Polb A G 8: 22,630,341 probably null Het
Pom121l2 T C 13: 21,983,353 I598T possibly damaging Het
Pxmp2 C T 5: 110,281,196 probably null Het
Rbm39 G T 2: 156,154,257 L403I probably benign Het
Rec8 T C 14: 55,622,275 probably null Het
Reck T C 4: 43,912,061 I190T probably benign Het
Rer1 A T 4: 155,075,593 I166N probably damaging Het
Rgs17 T A 10: 5,842,567 K60* probably null Het
Ripor2 C T 13: 24,675,785 T152M probably damaging Het
Scgb1b2 A T 7: 31,291,775 probably benign Het
Scn3a C A 2: 65,514,635 R503M probably damaging Het
Scn4a C A 11: 106,345,541 D298Y probably benign Het
Scn9a A G 2: 66,484,304 F1679S probably damaging Het
Scyl3 G T 1: 163,939,984 probably null Het
Sec23ip A G 7: 128,766,281 probably null Het
She C T 3: 89,849,614 A325V possibly damaging Het
Skint2 T G 4: 112,625,998 M200R probably damaging Het
Slc17a5 A T 9: 78,578,699 C35S probably damaging Het
Slc25a24 T A 3: 109,163,503 S393T probably damaging Het
Slc6a19 C T 13: 73,686,124 V320M probably damaging Het
Snap91 T C 9: 86,792,196 D579G possibly damaging Het
Spats2l C T 1: 57,946,224 R479C probably damaging Het
Syngr3 G C 17: 24,686,668 probably null Het
Tas2r107 A C 6: 131,659,822 I88R probably damaging Het
Them7 A T 2: 105,297,914 N80I probably damaging Het
Tmprss7 C T 16: 45,662,153 probably null Het
Tnrc6b A G 15: 80,880,168 N624D possibly damaging Het
Trpm2 T G 10: 77,942,999 I378L probably benign Het
Ttn C A 2: 76,724,532 W30676L probably damaging Het
Ttn A G 2: 76,944,040 V2220A unknown Het
Uba6 T C 5: 86,154,407 T134A probably benign Het
Vmn2r55 A G 7: 12,684,751 S81P probably damaging Het
Zfp616 T A 11: 74,084,722 S606T probably damaging Het
Zfp653 C A 9: 22,055,859 A577S probably damaging Het
Other mutations in Napsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Napsa APN 7 44581421 missense probably benign 0.00
IGL01380:Napsa APN 7 44586674 missense probably damaging 0.99
IGL01521:Napsa APN 7 44586637 missense probably damaging 1.00
IGL01630:Napsa APN 7 44586665 missense probably damaging 1.00
IGL01862:Napsa APN 7 44582493 missense probably damaging 0.99
IGL01935:Napsa APN 7 44586622 missense probably benign 0.01
IGL02421:Napsa APN 7 44585055 missense probably damaging 1.00
IGL02831:Napsa APN 7 44586760 missense probably benign
IGL03008:Napsa APN 7 44585796 missense possibly damaging 0.77
PIT4131001:Napsa UTSW 7 44581451 missense probably damaging 1.00
R0422:Napsa UTSW 7 44585106 missense probably damaging 1.00
R1542:Napsa UTSW 7 44581689 missense probably damaging 1.00
R1903:Napsa UTSW 7 44581736 missense probably damaging 1.00
R1964:Napsa UTSW 7 44581685 missense probably benign 0.01
R2366:Napsa UTSW 7 44582485 missense probably damaging 1.00
R3713:Napsa UTSW 7 44581428 missense probably damaging 1.00
R5441:Napsa UTSW 7 44581393 unclassified probably benign
R5512:Napsa UTSW 7 44572616 start codon destroyed probably null 0.01
R5682:Napsa UTSW 7 44585344 missense possibly damaging 0.92
R6290:Napsa UTSW 7 44581337 missense probably benign 0.00
R7046:Napsa UTSW 7 44585085 missense probably damaging 1.00
R7134:Napsa UTSW 7 44585735 missense not run
Predicted Primers PCR Primer
(F):5'- ATGGGACAATCAAACCCGGAGC -3'
(R):5'- TCGCACCCTGCAAAATGGGATG -3'

Sequencing Primer
(F):5'- CCCCGTGATACACAGTATCCTG -3'
(R):5'- GGTCTGTTGAACGAGACTGA -3'
Posted On2014-04-24