Incidental Mutation 'R1564:Trpm2'
ID175131
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 039603-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R1564 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 77942999 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 378 (I378L)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably benign
Transcript: ENSMUST00000105401
AA Change: I378L

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: I378L

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik T C 13: 19,729,300 noncoding transcript Het
Abca13 C T 11: 9,434,316 Q3923* probably null Het
Abcc12 T A 8: 86,517,486 T1013S probably benign Het
Acad9 T C 3: 36,089,429 I558T possibly damaging Het
Agbl4 C A 4: 110,955,564 probably null Het
Akr1b3 C T 6: 34,306,535 probably null Het
Aktip A G 8: 91,131,081 M1T probably null Het
Apc G T 18: 34,315,149 Q1665H probably benign Het
Arfgef3 T C 10: 18,591,704 D1916G probably damaging Het
Arhgef11 T C 3: 87,702,510 V365A probably benign Het
Bank1 C A 3: 136,213,841 E265* probably null Het
Bbs7 A T 3: 36,575,795 D578E probably damaging Het
Bin3 T C 14: 70,134,769 F172L probably damaging Het
Bves A G 10: 45,369,281 D350G probably benign Het
Cacna1h A T 17: 25,377,861 C80* probably null Het
Cacna2d4 T C 6: 119,241,195 F164L possibly damaging Het
Cenpj T C 14: 56,552,066 D842G probably benign Het
Col12a1 C A 9: 79,613,840 R2781L probably damaging Het
Cyp2c68 A T 19: 39,735,580 C213* probably null Het
Defb33 T A 8: 20,897,581 C45S possibly damaging Het
Dolk A T 2: 30,285,621 N137K probably damaging Het
Fam171b G A 2: 83,880,284 E767K probably damaging Het
Fbxl20 A T 11: 98,098,486 D189E probably damaging Het
Gm10643 A T 8: 84,064,482 M1K probably null Het
Gm572 T G 4: 148,651,186 I24S possibly damaging Het
Gnpda1 A G 18: 38,338,089 probably null Het
Helz2 G T 2: 181,233,228 N1824K probably benign Het
Insl3 G T 8: 71,690,291 A99S possibly damaging Het
Lpin2 G A 17: 71,225,060 V137I probably benign Het
Lrrc9 A G 12: 72,487,053 E1032G probably damaging Het
Macf1 T C 4: 123,459,357 T1510A probably benign Het
Mnd1 T C 3: 84,116,431 E116G probably benign Het
Mycbp2 A G 14: 103,169,851 probably null Het
Myoz3 G A 18: 60,580,842 S23L probably benign Het
Napsa G T 7: 44,586,649 V371F probably damaging Het
Nefh T C 11: 4,939,878 T914A unknown Het
Neurod2 A T 11: 98,327,424 C305S probably damaging Het
Nmnat3 T C 9: 98,354,166 probably null Het
Nuf2 A G 1: 169,498,793 V463A unknown Het
Olfml1 A T 7: 107,571,139 T78S possibly damaging Het
Olfr1199 A T 2: 88,756,656 N6K possibly damaging Het
Olfr1228 G T 2: 89,249,672 N7K probably benign Het
Olfr61 G A 7: 140,638,054 V118I probably benign Het
Olfr800 T C 10: 129,660,015 F70L probably benign Het
Opcml G A 9: 28,903,316 C288Y probably damaging Het
Oprl1 T C 2: 181,718,940 I222T possibly damaging Het
Pcsk5 A G 19: 17,654,756 Y349H probably damaging Het
Pla2g4d C A 2: 120,268,903 R706L possibly damaging Het
Pmm1 A G 15: 81,956,200 Y55H probably damaging Het
Polb A G 8: 22,630,341 probably null Het
Pom121l2 T C 13: 21,983,353 I598T possibly damaging Het
Pxmp2 C T 5: 110,281,196 probably null Het
Rbm39 G T 2: 156,154,257 L403I probably benign Het
Rec8 T C 14: 55,622,275 probably null Het
Reck T C 4: 43,912,061 I190T probably benign Het
Rer1 A T 4: 155,075,593 I166N probably damaging Het
Rgs17 T A 10: 5,842,567 K60* probably null Het
Ripor2 C T 13: 24,675,785 T152M probably damaging Het
Scgb1b2 A T 7: 31,291,775 probably benign Het
Scn3a C A 2: 65,514,635 R503M probably damaging Het
Scn4a C A 11: 106,345,541 D298Y probably benign Het
Scn9a A G 2: 66,484,304 F1679S probably damaging Het
Scyl3 G T 1: 163,939,984 probably null Het
Sec23ip A G 7: 128,766,281 probably null Het
She C T 3: 89,849,614 A325V possibly damaging Het
Skint2 T G 4: 112,625,998 M200R probably damaging Het
Slc17a5 A T 9: 78,578,699 C35S probably damaging Het
Slc25a24 T A 3: 109,163,503 S393T probably damaging Het
Slc6a19 C T 13: 73,686,124 V320M probably damaging Het
Snap91 T C 9: 86,792,196 D579G possibly damaging Het
Spats2l C T 1: 57,946,224 R479C probably damaging Het
Syngr3 G C 17: 24,686,668 probably null Het
Tas2r107 A C 6: 131,659,822 I88R probably damaging Het
Them7 A T 2: 105,297,914 N80I probably damaging Het
Tmprss7 C T 16: 45,662,153 probably null Het
Tnrc6b A G 15: 80,880,168 N624D possibly damaging Het
Ttn C A 2: 76,724,532 W30676L probably damaging Het
Ttn A G 2: 76,944,040 V2220A unknown Het
Uba6 T C 5: 86,154,407 T134A probably benign Het
Vmn2r55 A G 7: 12,684,751 S81P probably damaging Het
Zfp616 T A 11: 74,084,722 S606T probably damaging Het
Zfp653 C A 9: 22,055,859 A577S probably damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77917792 missense probably benign 0.34
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense not run
Predicted Primers PCR Primer
(F):5'- TGCTTCAAACTCTCAGTGCCCAAC -3'
(R):5'- CTGGCAGCAAATGGGATGCAAC -3'

Sequencing Primer
(F):5'- GGTTCAGAGCCCCCATCATC -3'
(R):5'- GCAACCTTAGCTGCTAGTGAATG -3'
Posted On2014-04-24