Incidental Mutation 'R1564:Rec8'
ID175146
Institutional Source Beutler Lab
Gene Symbol Rec8
Ensembl Gene ENSMUSG00000002324
Gene NameREC8 meiotic recombination protein
Synonymsmrec, Rec8L1
MMRRC Submission 039603-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1564 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55618037-55625395 bp(+) (GRCm38)
Type of Mutationunclassified (3449 bp from exon)
DNA Base Change (assembly) T to C at 55622275 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002395] [ENSMUST00000047131] [ENSMUST00000135221] [ENSMUST00000141499] [ENSMUST00000148351]
Predicted Effect probably damaging
Transcript: ENSMUST00000002395
AA Change: I204T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002395
Gene: ENSMUSG00000002324
AA Change: I204T

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 117 2.2e-26 PFAM
low complexity region 235 249 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
Pfam:Rad21_Rec8 536 590 9.2e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141425
Predicted Effect probably null
Transcript: ENSMUST00000141499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146528
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227922
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kleisin family of SMC (structural maintenance of chromosome) protein partners. The protein localizes to the axial elements of chromosomes during meiosis in both oocytes and spermatocytes. In the mouse, the homologous protein is a key component of the meiotic cohesion complex, which regulates sister chromatid cohesion and recombination between homologous chromosomes. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are infertile and exhibit small ovaries and testes. Females show absence of ovarian follicles and abnormal meiosis, while males exhibit abnormal chromosome pairing during meiosis, abnormal synaptonemal complex formation, and arrest of male meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik T C 13: 19,729,300 noncoding transcript Het
Abca13 C T 11: 9,434,316 Q3923* probably null Het
Abcc12 T A 8: 86,517,486 T1013S probably benign Het
Acad9 T C 3: 36,089,429 I558T possibly damaging Het
Agbl4 C A 4: 110,955,564 probably null Het
Akr1b3 C T 6: 34,306,535 probably null Het
Aktip A G 8: 91,131,081 M1T probably null Het
Apc G T 18: 34,315,149 Q1665H probably benign Het
Arfgef3 T C 10: 18,591,704 D1916G probably damaging Het
Arhgef11 T C 3: 87,702,510 V365A probably benign Het
Bank1 C A 3: 136,213,841 E265* probably null Het
Bbs7 A T 3: 36,575,795 D578E probably damaging Het
Bin3 T C 14: 70,134,769 F172L probably damaging Het
Bves A G 10: 45,369,281 D350G probably benign Het
Cacna1h A T 17: 25,377,861 C80* probably null Het
Cacna2d4 T C 6: 119,241,195 F164L possibly damaging Het
Cenpj T C 14: 56,552,066 D842G probably benign Het
Col12a1 C A 9: 79,613,840 R2781L probably damaging Het
Cyp2c68 A T 19: 39,735,580 C213* probably null Het
Defb33 T A 8: 20,897,581 C45S possibly damaging Het
Dolk A T 2: 30,285,621 N137K probably damaging Het
Fam171b G A 2: 83,880,284 E767K probably damaging Het
Fbxl20 A T 11: 98,098,486 D189E probably damaging Het
Gm10643 A T 8: 84,064,482 M1K probably null Het
Gm572 T G 4: 148,651,186 I24S possibly damaging Het
Gnpda1 A G 18: 38,338,089 probably null Het
Helz2 G T 2: 181,233,228 N1824K probably benign Het
Insl3 G T 8: 71,690,291 A99S possibly damaging Het
Lpin2 G A 17: 71,225,060 V137I probably benign Het
Lrrc9 A G 12: 72,487,053 E1032G probably damaging Het
Macf1 T C 4: 123,459,357 T1510A probably benign Het
Mnd1 T C 3: 84,116,431 E116G probably benign Het
Mycbp2 A G 14: 103,169,851 probably null Het
Myoz3 G A 18: 60,580,842 S23L probably benign Het
Napsa G T 7: 44,586,649 V371F probably damaging Het
Nefh T C 11: 4,939,878 T914A unknown Het
Neurod2 A T 11: 98,327,424 C305S probably damaging Het
Nmnat3 T C 9: 98,354,166 probably null Het
Nuf2 A G 1: 169,498,793 V463A unknown Het
Olfml1 A T 7: 107,571,139 T78S possibly damaging Het
Olfr1199 A T 2: 88,756,656 N6K possibly damaging Het
Olfr1228 G T 2: 89,249,672 N7K probably benign Het
Olfr61 G A 7: 140,638,054 V118I probably benign Het
Olfr800 T C 10: 129,660,015 F70L probably benign Het
Opcml G A 9: 28,903,316 C288Y probably damaging Het
Oprl1 T C 2: 181,718,940 I222T possibly damaging Het
Pcsk5 A G 19: 17,654,756 Y349H probably damaging Het
Pla2g4d C A 2: 120,268,903 R706L possibly damaging Het
Pmm1 A G 15: 81,956,200 Y55H probably damaging Het
Polb A G 8: 22,630,341 probably null Het
Pom121l2 T C 13: 21,983,353 I598T possibly damaging Het
Pxmp2 C T 5: 110,281,196 probably null Het
Rbm39 G T 2: 156,154,257 L403I probably benign Het
Reck T C 4: 43,912,061 I190T probably benign Het
Rer1 A T 4: 155,075,593 I166N probably damaging Het
Rgs17 T A 10: 5,842,567 K60* probably null Het
Ripor2 C T 13: 24,675,785 T152M probably damaging Het
Scgb1b2 A T 7: 31,291,775 probably benign Het
Scn3a C A 2: 65,514,635 R503M probably damaging Het
Scn4a C A 11: 106,345,541 D298Y probably benign Het
Scn9a A G 2: 66,484,304 F1679S probably damaging Het
Scyl3 G T 1: 163,939,984 probably null Het
Sec23ip A G 7: 128,766,281 probably null Het
She C T 3: 89,849,614 A325V possibly damaging Het
Skint2 T G 4: 112,625,998 M200R probably damaging Het
Slc17a5 A T 9: 78,578,699 C35S probably damaging Het
Slc25a24 T A 3: 109,163,503 S393T probably damaging Het
Slc6a19 C T 13: 73,686,124 V320M probably damaging Het
Snap91 T C 9: 86,792,196 D579G possibly damaging Het
Spats2l C T 1: 57,946,224 R479C probably damaging Het
Syngr3 G C 17: 24,686,668 probably null Het
Tas2r107 A C 6: 131,659,822 I88R probably damaging Het
Them7 A T 2: 105,297,914 N80I probably damaging Het
Tmprss7 C T 16: 45,662,153 probably null Het
Tnrc6b A G 15: 80,880,168 N624D possibly damaging Het
Trpm2 T G 10: 77,942,999 I378L probably benign Het
Ttn C A 2: 76,724,532 W30676L probably damaging Het
Ttn A G 2: 76,944,040 V2220A unknown Het
Uba6 T C 5: 86,154,407 T134A probably benign Het
Vmn2r55 A G 7: 12,684,751 S81P probably damaging Het
Zfp616 T A 11: 74,084,722 S606T probably damaging Het
Zfp653 C A 9: 22,055,859 A577S probably damaging Het
Other mutations in Rec8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Rec8 APN 14 55623515 nonsense probably null
IGL00427:Rec8 APN 14 55618651 missense probably damaging 1.00
IGL02116:Rec8 APN 14 55624879 unclassified probably null
R1349:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1372:Rec8 UTSW 14 55618974 missense probably damaging 1.00
R1667:Rec8 UTSW 14 55618796 missense probably damaging 1.00
R1970:Rec8 UTSW 14 55624142 missense probably damaging 1.00
R3157:Rec8 UTSW 14 55625306 missense probably damaging 0.96
R3625:Rec8 UTSW 14 55622497 missense possibly damaging 0.94
R3919:Rec8 UTSW 14 55621259 missense probably benign 0.02
R4280:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4282:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4283:Rec8 UTSW 14 55618634 missense probably damaging 1.00
R4622:Rec8 UTSW 14 55624758 missense probably damaging 1.00
R4894:Rec8 UTSW 14 55625330 missense probably damaging 1.00
R5488:Rec8 UTSW 14 55622826 missense probably benign 0.00
R5489:Rec8 UTSW 14 55622826 missense probably benign 0.00
R6113:Rec8 UTSW 14 55622478 missense probably damaging 0.99
R6264:Rec8 UTSW 14 55619179 missense probably damaging 1.00
R6439:Rec8 UTSW 14 55618619 missense possibly damaging 0.50
Z1088:Rec8 UTSW 14 55625147 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCCTGGCTCTTAGGCTCCAAAG -3'
(R):5'- ACCATCCAGTGGTAGTGAAGCTCTC -3'

Sequencing Primer
(F):5'- AAAGTCCATGTTTTTGCCCCAAC -3'
(R):5'- ACGTTCCTCTAGCAAGATGG -3'
Posted On2014-04-24