Incidental Mutation 'R1566:Ttc28'
ID175257
Institutional Source Beutler Lab
Gene Symbol Ttc28
Ensembl Gene ENSMUSG00000033209
Gene Nametetratricopeptide repeat domain 28
Synonyms
MMRRC Submission 039605-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.602) question?
Stock #R1566 (G1)
Quality Score113
Status Not validated
Chromosome5
Chromosomal Location110879803-111289780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111225677 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 962 (S962N)
Ref Sequence ENSEMBL: ENSMUSP00000137609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040111] [ENSMUST00000156290]
Predicted Effect probably damaging
Transcript: ENSMUST00000040111
AA Change: S993N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136116
Gene: ENSMUSG00000033209
AA Change: S993N

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 339 372 1.78e-1 SMART
TPR 379 412 2.82e-4 SMART
TPR 419 452 9.98e-5 SMART
TPR 459 492 1.88e0 SMART
TPR 499 532 1.11e1 SMART
TPR 539 572 2.93e-2 SMART
TPR 579 612 1.21e-3 SMART
TPR 619 652 4.91e-4 SMART
TPR 659 692 7.56e-5 SMART
TPR 699 732 8.29e0 SMART
TPR 739 772 1.63e0 SMART
TPR 779 812 1.24e0 SMART
TPR 819 852 7.98e-4 SMART
TPR 859 892 8.74e0 SMART
TPR 902 935 5.43e-6 SMART
TPR 942 975 4.09e-1 SMART
TPR 982 1015 9.98e-5 SMART
TPR 1022 1055 7.12e-1 SMART
TPR 1062 1095 5.69e0 SMART
TPR 1102 1135 3.14e-2 SMART
TPR 1142 1175 2.84e1 SMART
low complexity region 1259 1277 N/A INTRINSIC
Pfam:CHAT 1415 1738 7.3e-77 PFAM
low complexity region 1972 1990 N/A INTRINSIC
low complexity region 2014 2031 N/A INTRINSIC
low complexity region 2033 2045 N/A INTRINSIC
low complexity region 2155 2171 N/A INTRINSIC
low complexity region 2283 2293 N/A INTRINSIC
low complexity region 2327 2352 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125470
Predicted Effect probably damaging
Transcript: ENSMUST00000156290
AA Change: S962N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137609
Gene: ENSMUSG00000033209
AA Change: S962N

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
TPR 52 85 2.84e1 SMART
TPR 86 119 5.03e-1 SMART
TPR 120 153 2.11e-3 SMART
TPR 268 301 8.51e0 SMART
TPR 308 341 1.78e-1 SMART
TPR 348 381 2.82e-4 SMART
TPR 388 421 9.98e-5 SMART
TPR 428 461 1.88e0 SMART
TPR 468 501 1.11e1 SMART
TPR 508 541 2.93e-2 SMART
TPR 548 581 1.21e-3 SMART
TPR 588 621 4.91e-4 SMART
TPR 628 661 7.56e-5 SMART
TPR 668 701 8.29e0 SMART
TPR 708 741 1.63e0 SMART
TPR 748 781 1.24e0 SMART
TPR 788 821 7.98e-4 SMART
TPR 828 861 8.74e0 SMART
TPR 871 904 5.43e-6 SMART
TPR 911 944 4.09e-1 SMART
TPR 951 984 9.98e-5 SMART
TPR 991 1024 7.12e-1 SMART
TPR 1031 1064 5.69e0 SMART
TPR 1071 1104 3.14e-2 SMART
TPR 1111 1144 2.84e1 SMART
low complexity region 1228 1246 N/A INTRINSIC
Pfam:CHAT 1384 1707 1.1e-76 PFAM
low complexity region 1941 1959 N/A INTRINSIC
low complexity region 1983 2000 N/A INTRINSIC
low complexity region 2002 2014 N/A INTRINSIC
low complexity region 2124 2140 N/A INTRINSIC
low complexity region 2252 2262 N/A INTRINSIC
low complexity region 2296 2321 N/A INTRINSIC
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T A 11: 109,788,806 I247F probably benign Het
Afap1l1 T C 18: 61,755,643 N119S probably benign Het
Ap2a1 T C 7: 44,903,480 D721G probably benign Het
Ap3m2 C T 8: 22,803,951 V28M probably damaging Het
Arhgef7 A G 8: 11,782,620 T32A possibly damaging Het
Avl9 C T 6: 56,736,482 R242* probably null Het
Bsn G A 9: 108,125,985 T407I probably benign Het
Capn3 A T 2: 120,502,993 R627S possibly damaging Het
Car13 G A 3: 14,650,698 R92Q probably benign Het
Clcn1 T C 6: 42,291,440 I149T possibly damaging Het
Col1a2 G T 6: 4,523,613 G514V probably damaging Het
Ctsw C A 19: 5,465,417 C347F probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Eml1 T A 12: 108,471,892 V97D probably damaging Het
Epb41l1 A G 2: 156,521,959 E796G probably benign Het
Gdnf A G 15: 7,834,414 K102R probably benign Het
Gm1110 T C 9: 26,880,870 E618G probably damaging Het
Gm8300 A T 12: 87,517,231 H112L probably benign Het
Gmnc T C 16: 26,963,939 D22G probably damaging Het
Greb1 T C 12: 16,711,828 D517G possibly damaging Het
Gsta1 A T 9: 78,242,459 K185* probably null Het
Ift88 A G 14: 57,441,011 D160G probably benign Het
Intu T A 3: 40,692,578 I627N probably damaging Het
Itgav T A 2: 83,736,630 F101L probably damaging Het
Kars C T 8: 111,997,658 V475I probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Klra7 A G 6: 130,231,601 V6A probably damaging Het
Krtap6-2 A G 16: 89,419,738 S114P unknown Het
Ldlrad4 T C 18: 68,250,598 S122P probably benign Het
Lig4 C A 8: 9,973,650 L43F probably benign Het
Mfsd4a T C 1: 132,059,179 D137G probably damaging Het
Mmel1 C T 4: 154,883,653 R149C probably damaging Het
Morc2b T A 17: 33,136,974 H608L probably benign Het
Mrgpra6 G A 7: 47,188,904 T182I probably benign Het
Nat8l C A 5: 34,000,856 N203K probably benign Het
Nin A T 12: 70,054,479 V448E probably damaging Het
Olfr1053 G A 2: 86,314,785 T167I probably benign Het
Olfr164 T A 16: 19,286,327 M139L possibly damaging Het
Olfr17 T G 7: 107,097,552 F29C probably damaging Het
Olfr178 T A 16: 58,889,540 I227F probably damaging Het
Pank4 T C 4: 154,980,521 L759P probably damaging Het
Pcm1 T A 8: 41,290,773 N1152K probably damaging Het
Pitpnm3 A T 11: 72,058,959 probably null Het
Plekhg3 T C 12: 76,572,065 M497T possibly damaging Het
Ppfia3 T C 7: 45,340,688 D1138G probably damaging Het
Prl6a1 T A 13: 27,315,427 S59R possibly damaging Het
Pth2r A G 1: 65,388,538 S457G possibly damaging Het
Rbm25 T A 12: 83,675,054 N671K probably damaging Het
Rbm26 T A 14: 105,160,544 K47N unknown Het
Ryr1 T A 7: 29,092,175 I1435F possibly damaging Het
Scin T A 12: 40,081,674 H287L probably benign Het
Serpinb9e T C 13: 33,253,494 L120P probably damaging Het
Slc34a1 A C 13: 55,412,031 probably null Het
Slc39a10 A G 1: 46,836,085 F19S possibly damaging Het
Sos1 A G 17: 80,453,916 V117A probably damaging Het
Spta1 C A 1: 174,184,706 N359K probably benign Het
Sspo G A 6: 48,466,870 probably null Het
Stx5a T A 19: 8,742,311 D13E probably damaging Het
Supt16 G A 14: 52,176,655 A489V probably damaging Het
Tap1 T A 17: 34,189,546 L253Q probably benign Het
Tmc6 A G 11: 117,769,436 S659P probably damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ugt8a T C 3: 125,875,558 Y299C probably damaging Het
Upk1a A G 7: 30,609,720 V59A possibly damaging Het
Usp38 T C 8: 80,984,803 T868A probably benign Het
Wdsub1 G A 2: 59,876,715 H58Y probably damaging Het
Zc3h7b T C 15: 81,768,834 S19P possibly damaging Het
Zfp385b A C 2: 77,415,913 F257V probably benign Het
Zmym4 A C 4: 126,911,147 I188S possibly damaging Het
Other mutations in Ttc28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ttc28 APN 5 111225688 missense probably damaging 1.00
IGL00963:Ttc28 APN 5 111286389 nonsense probably null
IGL00969:Ttc28 APN 5 111225740 missense probably benign 0.00
IGL01366:Ttc28 APN 5 111085171 critical splice donor site probably null
IGL01528:Ttc28 APN 5 111101960 splice site probably benign
IGL01558:Ttc28 APN 5 111283962 missense probably damaging 0.99
IGL01973:Ttc28 APN 5 111224235 missense possibly damaging 0.88
IGL02040:Ttc28 APN 5 110892936 nonsense probably null
IGL02432:Ttc28 APN 5 111223235 missense probably damaging 1.00
IGL02531:Ttc28 APN 5 111225850 missense probably damaging 1.00
IGL02819:Ttc28 APN 5 111266583 missense probably benign
IGL02830:Ttc28 APN 5 111286239 missense probably benign 0.10
IGL02893:Ttc28 APN 5 111285385 missense possibly damaging 0.87
IGL03387:Ttc28 APN 5 111233342 missense probably benign 0.07
PIT4131001:Ttc28 UTSW 5 110892853 missense probably benign 0.00
R0142:Ttc28 UTSW 5 111277457 missense probably benign 0.40
R0166:Ttc28 UTSW 5 111225634 missense probably benign 0.01
R0328:Ttc28 UTSW 5 111284067 splice site probably benign
R0582:Ttc28 UTSW 5 111183296 missense probably damaging 1.00
R0744:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R0811:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0812:Ttc28 UTSW 5 111235500 missense probably benign 0.24
R0828:Ttc28 UTSW 5 111223446 missense probably damaging 1.00
R0833:Ttc28 UTSW 5 111231081 missense probably damaging 1.00
R1013:Ttc28 UTSW 5 111276965 missense probably benign 0.01
R1168:Ttc28 UTSW 5 111231111 missense probably damaging 1.00
R1194:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1195:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1196:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1205:Ttc28 UTSW 5 111285769 missense probably benign 0.04
R1386:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1467:Ttc28 UTSW 5 111285388 missense probably benign 0.00
R1537:Ttc28 UTSW 5 111285318 missense probably damaging 0.96
R1539:Ttc28 UTSW 5 111100811 missense possibly damaging 0.77
R1558:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1560:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1561:Ttc28 UTSW 5 111225677 missense probably damaging 1.00
R1768:Ttc28 UTSW 5 111277168 missense possibly damaging 0.77
R1775:Ttc28 UTSW 5 111276811 missense probably benign 0.00
R1909:Ttc28 UTSW 5 111284054 critical splice donor site probably null
R1911:Ttc28 UTSW 5 111280750 missense possibly damaging 0.93
R1970:Ttc28 UTSW 5 111235635 missense probably benign 0.00
R1990:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R1992:Ttc28 UTSW 5 111276322 missense probably benign 0.37
R2066:Ttc28 UTSW 5 111225933 missense probably benign 0.01
R2112:Ttc28 UTSW 5 111276273 missense probably damaging 0.99
R2158:Ttc28 UTSW 5 111177617 intron probably benign
R2192:Ttc28 UTSW 5 111223496 missense probably damaging 0.99
R2267:Ttc28 UTSW 5 111226003 missense possibly damaging 0.75
R2384:Ttc28 UTSW 5 111276208 missense possibly damaging 0.95
R2989:Ttc28 UTSW 5 111224015 missense probably benign 0.29
R3881:Ttc28 UTSW 5 111183240 missense probably damaging 1.00
R3919:Ttc28 UTSW 5 111285379 missense possibly damaging 0.80
R4455:Ttc28 UTSW 5 111224058 frame shift probably null
R4456:Ttc28 UTSW 5 111224058 frame shift probably null
R4522:Ttc28 UTSW 5 111280172 missense probably benign 0.01
R4548:Ttc28 UTSW 5 111271224 missense possibly damaging 0.86
R4591:Ttc28 UTSW 5 111223281 missense probably damaging 1.00
R4633:Ttc28 UTSW 5 111224001 missense probably damaging 1.00
R4700:Ttc28 UTSW 5 111277043 missense probably damaging 1.00
R4714:Ttc28 UTSW 5 111285229 missense possibly damaging 0.65
R4790:Ttc28 UTSW 5 111224217 missense possibly damaging 0.94
R4803:Ttc28 UTSW 5 111277463 missense possibly damaging 0.90
R4840:Ttc28 UTSW 5 111286081 missense probably damaging 1.00
R4969:Ttc28 UTSW 5 111276255 missense probably damaging 0.96
R5019:Ttc28 UTSW 5 111102064 missense possibly damaging 0.47
R5130:Ttc28 UTSW 5 110892856 missense probably benign
R5150:Ttc28 UTSW 5 111225689 missense probably damaging 1.00
R5214:Ttc28 UTSW 5 111177623 intron probably benign
R5254:Ttc28 UTSW 5 111271238 missense probably benign 0.01
R5518:Ttc28 UTSW 5 111225928 missense probably benign 0.17
R5851:Ttc28 UTSW 5 111235469 splice site probably benign
R5931:Ttc28 UTSW 5 111085109 missense possibly damaging 0.81
R6011:Ttc28 UTSW 5 111286443 missense probably benign
R6176:Ttc28 UTSW 5 111223985 missense probably damaging 1.00
R6221:Ttc28 UTSW 5 111271248 missense probably benign 0.00
R6398:Ttc28 UTSW 5 111276276 missense probably damaging 1.00
R6717:Ttc28 UTSW 5 111285436 missense probably benign
R6770:Ttc28 UTSW 5 111286140 missense probably damaging 1.00
R6901:Ttc28 UTSW 5 111277025 missense possibly damaging 0.88
R7038:Ttc28 UTSW 5 111266579 missense probably benign 0.09
R7073:Ttc28 UTSW 5 111223416 missense not run
R7101:Ttc28 UTSW 5 111085092 missense not run
R7135:Ttc28 UTSW 5 111280007 missense not run
V8831:Ttc28 UTSW 5 111100712 missense probably benign 0.11
Z1088:Ttc28 UTSW 5 111286315 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACCTGCACAGAGTGATCTCATTG -3'
(R):5'- TGATAGACCACAGCCCTCTCGAAG -3'

Sequencing Primer
(F):5'- AGAGTGATCTCATTGCTTCTCTG -3'
(R):5'- ACTCGTAGGTGAGTCCCAG -3'
Posted On2014-04-24