Incidental Mutation 'R1566:Clcn1'
ID175260
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission 039605-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R1566 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42291440 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 149 (I149T)
Ref Sequence ENSEMBL: ENSMUSP00000126045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect probably benign
Transcript: ENSMUST00000031894
AA Change: I182T

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: I182T

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: I152T
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: I152T

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
AA Change: I182T

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862
AA Change: I182T

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165780
AA Change: I152T
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862
AA Change: I152T

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168660
AA Change: I149T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862
AA Change: I149T

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169024
AA Change: I152T
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862
AA Change: I152T

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170028
AA Change: I152T
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862
AA Change: I152T

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T A 11: 109,788,806 I247F probably benign Het
Afap1l1 T C 18: 61,755,643 N119S probably benign Het
Ap2a1 T C 7: 44,903,480 D721G probably benign Het
Ap3m2 C T 8: 22,803,951 V28M probably damaging Het
Arhgef7 A G 8: 11,782,620 T32A possibly damaging Het
Avl9 C T 6: 56,736,482 R242* probably null Het
Bsn G A 9: 108,125,985 T407I probably benign Het
Capn3 A T 2: 120,502,993 R627S possibly damaging Het
Car13 G A 3: 14,650,698 R92Q probably benign Het
Col1a2 G T 6: 4,523,613 G514V probably damaging Het
Ctsw C A 19: 5,465,417 C347F probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Eml1 T A 12: 108,471,892 V97D probably damaging Het
Epb41l1 A G 2: 156,521,959 E796G probably benign Het
Gdnf A G 15: 7,834,414 K102R probably benign Het
Gm1110 T C 9: 26,880,870 E618G probably damaging Het
Gm8300 A T 12: 87,517,231 H112L probably benign Het
Gmnc T C 16: 26,963,939 D22G probably damaging Het
Greb1 T C 12: 16,711,828 D517G possibly damaging Het
Gsta1 A T 9: 78,242,459 K185* probably null Het
Ift88 A G 14: 57,441,011 D160G probably benign Het
Intu T A 3: 40,692,578 I627N probably damaging Het
Itgav T A 2: 83,736,630 F101L probably damaging Het
Kars C T 8: 111,997,658 V475I probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Klra7 A G 6: 130,231,601 V6A probably damaging Het
Krtap6-2 A G 16: 89,419,738 S114P unknown Het
Ldlrad4 T C 18: 68,250,598 S122P probably benign Het
Lig4 C A 8: 9,973,650 L43F probably benign Het
Mfsd4a T C 1: 132,059,179 D137G probably damaging Het
Mmel1 C T 4: 154,883,653 R149C probably damaging Het
Morc2b T A 17: 33,136,974 H608L probably benign Het
Mrgpra6 G A 7: 47,188,904 T182I probably benign Het
Nat8l C A 5: 34,000,856 N203K probably benign Het
Nin A T 12: 70,054,479 V448E probably damaging Het
Olfr1053 G A 2: 86,314,785 T167I probably benign Het
Olfr164 T A 16: 19,286,327 M139L possibly damaging Het
Olfr17 T G 7: 107,097,552 F29C probably damaging Het
Olfr178 T A 16: 58,889,540 I227F probably damaging Het
Pank4 T C 4: 154,980,521 L759P probably damaging Het
Pcm1 T A 8: 41,290,773 N1152K probably damaging Het
Pitpnm3 A T 11: 72,058,959 probably null Het
Plekhg3 T C 12: 76,572,065 M497T possibly damaging Het
Ppfia3 T C 7: 45,340,688 D1138G probably damaging Het
Prl6a1 T A 13: 27,315,427 S59R possibly damaging Het
Pth2r A G 1: 65,388,538 S457G possibly damaging Het
Rbm25 T A 12: 83,675,054 N671K probably damaging Het
Rbm26 T A 14: 105,160,544 K47N unknown Het
Ryr1 T A 7: 29,092,175 I1435F possibly damaging Het
Scin T A 12: 40,081,674 H287L probably benign Het
Serpinb9e T C 13: 33,253,494 L120P probably damaging Het
Slc34a1 A C 13: 55,412,031 probably null Het
Slc39a10 A G 1: 46,836,085 F19S possibly damaging Het
Sos1 A G 17: 80,453,916 V117A probably damaging Het
Spta1 C A 1: 174,184,706 N359K probably benign Het
Sspo G A 6: 48,466,870 probably null Het
Stx5a T A 19: 8,742,311 D13E probably damaging Het
Supt16 G A 14: 52,176,655 A489V probably damaging Het
Tap1 T A 17: 34,189,546 L253Q probably benign Het
Tmc6 A G 11: 117,769,436 S659P probably damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ugt8a T C 3: 125,875,558 Y299C probably damaging Het
Upk1a A G 7: 30,609,720 V59A possibly damaging Het
Usp38 T C 8: 80,984,803 T868A probably benign Het
Wdsub1 G A 2: 59,876,715 H58Y probably damaging Het
Zc3h7b T C 15: 81,768,834 S19P possibly damaging Het
Zfp385b A C 2: 77,415,913 F257V probably benign Het
Zmym4 A C 4: 126,911,147 I188S possibly damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1861:Clcn1 UTSW 6 42313991 missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGACAGATAGCCACCTCCCTTAG -3'
(R):5'- GTGAGAAACTTCCAAGGCTTCCCC -3'

Sequencing Primer
(F):5'- TGAGAGCAAGTTGGCATACTATCC -3'
(R):5'- TTGTCCATAGCCGAGTTCAG -3'
Posted On2014-04-24