Incidental Mutation 'R1566:Ppfia3'
ID175269
Institutional Source Beutler Lab
Gene Symbol Ppfia3
Ensembl Gene ENSMUSG00000003863
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms
MMRRC Submission 039605-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1566 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45339122-45367019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45340688 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1138 (D1138G)
Ref Sequence ENSEMBL: ENSMUSP00000148200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000085351] [ENSMUST00000210248] [ENSMUST00000211067] [ENSMUST00000211327]
Predicted Effect probably damaging
Transcript: ENSMUST00000003961
AA Change: D1138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863
AA Change: D1138G

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085351
SMART Domains Protein: ENSMUSP00000082459
Gene: ENSMUSG00000038239

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
internal_repeat_1 51 146 8.76e-11 PROSPERO
low complexity region 154 189 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 213 225 1e-4 PFAM
low complexity region 240 254 N/A INTRINSIC
low complexity region 260 274 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
Pfam:Hist_rich_Ca-bd 308 324 2.2e-8 PFAM
low complexity region 340 353 N/A INTRINSIC
low complexity region 362 382 N/A INTRINSIC
internal_repeat_1 399 490 8.76e-11 PROSPERO
coiled coil region 536 565 N/A INTRINSIC
low complexity region 571 582 N/A INTRINSIC
coiled coil region 594 621 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210248
AA Change: D978G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210844
Predicted Effect probably damaging
Transcript: ENSMUST00000211067
AA Change: D1138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211098
Predicted Effect probably benign
Transcript: ENSMUST00000211327
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. Liprin family protein has been shown to localize phosphatase LAR to cell focal adhesions and may be involved in the molecular organization of presynaptic active zones. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T A 11: 109,788,806 I247F probably benign Het
Afap1l1 T C 18: 61,755,643 N119S probably benign Het
Ap2a1 T C 7: 44,903,480 D721G probably benign Het
Ap3m2 C T 8: 22,803,951 V28M probably damaging Het
Arhgef7 A G 8: 11,782,620 T32A possibly damaging Het
Avl9 C T 6: 56,736,482 R242* probably null Het
Bsn G A 9: 108,125,985 T407I probably benign Het
Capn3 A T 2: 120,502,993 R627S possibly damaging Het
Car13 G A 3: 14,650,698 R92Q probably benign Het
Clcn1 T C 6: 42,291,440 I149T possibly damaging Het
Col1a2 G T 6: 4,523,613 G514V probably damaging Het
Ctsw C A 19: 5,465,417 C347F probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Eml1 T A 12: 108,471,892 V97D probably damaging Het
Epb41l1 A G 2: 156,521,959 E796G probably benign Het
Gdnf A G 15: 7,834,414 K102R probably benign Het
Gm1110 T C 9: 26,880,870 E618G probably damaging Het
Gm8300 A T 12: 87,517,231 H112L probably benign Het
Gmnc T C 16: 26,963,939 D22G probably damaging Het
Greb1 T C 12: 16,711,828 D517G possibly damaging Het
Gsta1 A T 9: 78,242,459 K185* probably null Het
Ift88 A G 14: 57,441,011 D160G probably benign Het
Intu T A 3: 40,692,578 I627N probably damaging Het
Itgav T A 2: 83,736,630 F101L probably damaging Het
Kars C T 8: 111,997,658 V475I probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Klra7 A G 6: 130,231,601 V6A probably damaging Het
Krtap6-2 A G 16: 89,419,738 S114P unknown Het
Ldlrad4 T C 18: 68,250,598 S122P probably benign Het
Lig4 C A 8: 9,973,650 L43F probably benign Het
Mfsd4a T C 1: 132,059,179 D137G probably damaging Het
Mmel1 C T 4: 154,883,653 R149C probably damaging Het
Morc2b T A 17: 33,136,974 H608L probably benign Het
Mrgpra6 G A 7: 47,188,904 T182I probably benign Het
Nat8l C A 5: 34,000,856 N203K probably benign Het
Nin A T 12: 70,054,479 V448E probably damaging Het
Olfr1053 G A 2: 86,314,785 T167I probably benign Het
Olfr164 T A 16: 19,286,327 M139L possibly damaging Het
Olfr17 T G 7: 107,097,552 F29C probably damaging Het
Olfr178 T A 16: 58,889,540 I227F probably damaging Het
Pank4 T C 4: 154,980,521 L759P probably damaging Het
Pcm1 T A 8: 41,290,773 N1152K probably damaging Het
Pitpnm3 A T 11: 72,058,959 probably null Het
Plekhg3 T C 12: 76,572,065 M497T possibly damaging Het
Prl6a1 T A 13: 27,315,427 S59R possibly damaging Het
Pth2r A G 1: 65,388,538 S457G possibly damaging Het
Rbm25 T A 12: 83,675,054 N671K probably damaging Het
Rbm26 T A 14: 105,160,544 K47N unknown Het
Ryr1 T A 7: 29,092,175 I1435F possibly damaging Het
Scin T A 12: 40,081,674 H287L probably benign Het
Serpinb9e T C 13: 33,253,494 L120P probably damaging Het
Slc34a1 A C 13: 55,412,031 probably null Het
Slc39a10 A G 1: 46,836,085 F19S possibly damaging Het
Sos1 A G 17: 80,453,916 V117A probably damaging Het
Spta1 C A 1: 174,184,706 N359K probably benign Het
Sspo G A 6: 48,466,870 probably null Het
Stx5a T A 19: 8,742,311 D13E probably damaging Het
Supt16 G A 14: 52,176,655 A489V probably damaging Het
Tap1 T A 17: 34,189,546 L253Q probably benign Het
Tmc6 A G 11: 117,769,436 S659P probably damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ugt8a T C 3: 125,875,558 Y299C probably damaging Het
Upk1a A G 7: 30,609,720 V59A possibly damaging Het
Usp38 T C 8: 80,984,803 T868A probably benign Het
Wdsub1 G A 2: 59,876,715 H58Y probably damaging Het
Zc3h7b T C 15: 81,768,834 S19P possibly damaging Het
Zfp385b A C 2: 77,415,913 F257V probably benign Het
Zmym4 A C 4: 126,911,147 I188S possibly damaging Het
Other mutations in Ppfia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ppfia3 APN 7 45360057 splice site probably null
IGL02086:Ppfia3 APN 7 45340572 unclassified probably benign
IGL02160:Ppfia3 APN 7 45360051 splice site probably benign
IGL02373:Ppfia3 APN 7 45358849 missense probably damaging 0.98
IGL02417:Ppfia3 APN 7 45341717 missense probably damaging 0.98
IGL02501:Ppfia3 APN 7 45354938 splice site probably benign
IGL02638:Ppfia3 APN 7 45356668 missense probably damaging 1.00
IGL03084:Ppfia3 APN 7 45340227 missense probably benign 0.00
R0207:Ppfia3 UTSW 7 45348534 missense probably damaging 1.00
R0962:Ppfia3 UTSW 7 45347722 splice site probably benign
R1086:Ppfia3 UTSW 7 45361758 missense probably damaging 1.00
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1677:Ppfia3 UTSW 7 45356666 missense probably benign 0.03
R1876:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.75
R2219:Ppfia3 UTSW 7 45354890 nonsense probably null
R2336:Ppfia3 UTSW 7 45356697 splice site probably null
R2843:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R2844:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R2846:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R4669:Ppfia3 UTSW 7 45352093 missense probably damaging 1.00
R4777:Ppfia3 UTSW 7 45341157 missense probably damaging 1.00
R4787:Ppfia3 UTSW 7 45340626 missense possibly damaging 0.89
R4994:Ppfia3 UTSW 7 45341118 missense probably damaging 1.00
R5042:Ppfia3 UTSW 7 45342341 missense probably damaging 1.00
R5821:Ppfia3 UTSW 7 45353616 missense probably damaging 0.96
R6116:Ppfia3 UTSW 7 45354703 missense probably damaging 1.00
R6515:Ppfia3 UTSW 7 45340233 missense possibly damaging 0.94
R6868:Ppfia3 UTSW 7 45353612 missense probably damaging 1.00
R6920:Ppfia3 UTSW 7 45358807 missense possibly damaging 0.46
R6935:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.47
R6978:Ppfia3 UTSW 7 45346848 missense probably benign 0.02
R7017:Ppfia3 UTSW 7 45358800 missense probably benign
R7027:Ppfia3 UTSW 7 45354736 missense possibly damaging 0.80
R7078:Ppfia3 UTSW 7 45360595 missense not run
Predicted Primers PCR Primer
(F):5'- TGCACACTAGCAGGAGTAAGTCCG -3'
(R):5'- ACCTCATCTCCTTAGGCACAGACAG -3'

Sequencing Primer
(F):5'- ccactgagccacacacc -3'
(R):5'- GTTGCACTTACAGATCAGCG -3'
Posted On2014-04-24