Incidental Mutation 'R1566:Greb1'
ID175286
Institutional Source Beutler Lab
Gene Symbol Greb1
Ensembl Gene ENSMUSG00000036523
Gene Namegene regulated by estrogen in breast cancer protein
Synonyms5730583K22Rik
MMRRC Submission 039605-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R1566 (G1)
Quality Score134
Status Not validated
Chromosome12
Chromosomal Location16670615-16800886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16711828 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 517 (D517G)
Ref Sequence ENSEMBL: ENSMUSP00000124348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048064] [ENSMUST00000159120] [ENSMUST00000162112]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048064
AA Change: D517G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044454
Gene: ENSMUSG00000036523
AA Change: D517G

DomainStartEndE-ValueType
Pfam:GREB1 1 1954 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159044
Predicted Effect possibly damaging
Transcript: ENSMUST00000159120
AA Change: D517G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125339
Gene: ENSMUSG00000036523
AA Change: D517G

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1596 1607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160347
SMART Domains Protein: ENSMUSP00000124897
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 121 4.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160575
Predicted Effect probably benign
Transcript: ENSMUST00000160627
SMART Domains Protein: ENSMUSP00000124922
Gene: ENSMUSG00000036523

DomainStartEndE-ValueType
Pfam:GREB1 1 122 1.8e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161036
Predicted Effect possibly damaging
Transcript: ENSMUST00000162112
AA Change: D517G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124348
Gene: ENSMUSG00000036523
AA Change: D517G

DomainStartEndE-ValueType
low complexity region 52 71 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 437 453 N/A INTRINSIC
low complexity region 480 503 N/A INTRINSIC
low complexity region 631 643 N/A INTRINSIC
low complexity region 1128 1146 N/A INTRINSIC
low complexity region 1224 1235 N/A INTRINSIC
low complexity region 1279 1293 N/A INTRINSIC
low complexity region 1624 1635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an estrogen-responsive gene that is an early response gene in the estrogen receptor-regulated pathway. It is thought to play an important role in hormone-responsive tissues and cancer. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T A 11: 109,788,806 I247F probably benign Het
Afap1l1 T C 18: 61,755,643 N119S probably benign Het
Ap2a1 T C 7: 44,903,480 D721G probably benign Het
Ap3m2 C T 8: 22,803,951 V28M probably damaging Het
Arhgef7 A G 8: 11,782,620 T32A possibly damaging Het
Avl9 C T 6: 56,736,482 R242* probably null Het
Bsn G A 9: 108,125,985 T407I probably benign Het
Capn3 A T 2: 120,502,993 R627S possibly damaging Het
Car13 G A 3: 14,650,698 R92Q probably benign Het
Clcn1 T C 6: 42,291,440 I149T possibly damaging Het
Col1a2 G T 6: 4,523,613 G514V probably damaging Het
Ctsw C A 19: 5,465,417 C347F probably damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Eml1 T A 12: 108,471,892 V97D probably damaging Het
Epb41l1 A G 2: 156,521,959 E796G probably benign Het
Gdnf A G 15: 7,834,414 K102R probably benign Het
Gm1110 T C 9: 26,880,870 E618G probably damaging Het
Gm8300 A T 12: 87,517,231 H112L probably benign Het
Gmnc T C 16: 26,963,939 D22G probably damaging Het
Gsta1 A T 9: 78,242,459 K185* probably null Het
Ift88 A G 14: 57,441,011 D160G probably benign Het
Intu T A 3: 40,692,578 I627N probably damaging Het
Itgav T A 2: 83,736,630 F101L probably damaging Het
Kars C T 8: 111,997,658 V475I probably benign Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Klra7 A G 6: 130,231,601 V6A probably damaging Het
Krtap6-2 A G 16: 89,419,738 S114P unknown Het
Ldlrad4 T C 18: 68,250,598 S122P probably benign Het
Lig4 C A 8: 9,973,650 L43F probably benign Het
Mfsd4a T C 1: 132,059,179 D137G probably damaging Het
Mmel1 C T 4: 154,883,653 R149C probably damaging Het
Morc2b T A 17: 33,136,974 H608L probably benign Het
Mrgpra6 G A 7: 47,188,904 T182I probably benign Het
Nat8l C A 5: 34,000,856 N203K probably benign Het
Nin A T 12: 70,054,479 V448E probably damaging Het
Olfr1053 G A 2: 86,314,785 T167I probably benign Het
Olfr164 T A 16: 19,286,327 M139L possibly damaging Het
Olfr17 T G 7: 107,097,552 F29C probably damaging Het
Olfr178 T A 16: 58,889,540 I227F probably damaging Het
Pank4 T C 4: 154,980,521 L759P probably damaging Het
Pcm1 T A 8: 41,290,773 N1152K probably damaging Het
Pitpnm3 A T 11: 72,058,959 probably null Het
Plekhg3 T C 12: 76,572,065 M497T possibly damaging Het
Ppfia3 T C 7: 45,340,688 D1138G probably damaging Het
Prl6a1 T A 13: 27,315,427 S59R possibly damaging Het
Pth2r A G 1: 65,388,538 S457G possibly damaging Het
Rbm25 T A 12: 83,675,054 N671K probably damaging Het
Rbm26 T A 14: 105,160,544 K47N unknown Het
Ryr1 T A 7: 29,092,175 I1435F possibly damaging Het
Scin T A 12: 40,081,674 H287L probably benign Het
Serpinb9e T C 13: 33,253,494 L120P probably damaging Het
Slc34a1 A C 13: 55,412,031 probably null Het
Slc39a10 A G 1: 46,836,085 F19S possibly damaging Het
Sos1 A G 17: 80,453,916 V117A probably damaging Het
Spta1 C A 1: 174,184,706 N359K probably benign Het
Sspo G A 6: 48,466,870 probably null Het
Stx5a T A 19: 8,742,311 D13E probably damaging Het
Supt16 G A 14: 52,176,655 A489V probably damaging Het
Tap1 T A 17: 34,189,546 L253Q probably benign Het
Tmc6 A G 11: 117,769,436 S659P probably damaging Het
Tnfsf14 T C 17: 57,193,876 D65G probably benign Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ugt8a T C 3: 125,875,558 Y299C probably damaging Het
Upk1a A G 7: 30,609,720 V59A possibly damaging Het
Usp38 T C 8: 80,984,803 T868A probably benign Het
Wdsub1 G A 2: 59,876,715 H58Y probably damaging Het
Zc3h7b T C 15: 81,768,834 S19P possibly damaging Het
Zfp385b A C 2: 77,415,913 F257V probably benign Het
Zmym4 A C 4: 126,911,147 I188S possibly damaging Het
Other mutations in Greb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Greb1 APN 12 16711961 missense probably damaging 1.00
IGL01316:Greb1 APN 12 16698586 missense probably benign 0.04
IGL01464:Greb1 APN 12 16714826 missense probably damaging 0.99
IGL01474:Greb1 APN 12 16684501 missense probably benign
IGL01522:Greb1 APN 12 16701201 missense probably damaging 1.00
IGL01824:Greb1 APN 12 16711716 nonsense probably null
IGL01837:Greb1 APN 12 16684451 missense probably benign 0.19
IGL01991:Greb1 APN 12 16699681 missense probably damaging 1.00
IGL01996:Greb1 APN 12 16690845 missense possibly damaging 0.70
IGL02213:Greb1 APN 12 16706232 missense probably damaging 1.00
IGL02267:Greb1 APN 12 16717208 missense probably benign 0.00
IGL02512:Greb1 APN 12 16692712 missense possibly damaging 0.79
IGL02583:Greb1 APN 12 16706295 splice site probably benign
IGL02613:Greb1 APN 12 16739888 critical splice donor site probably null
IGL02648:Greb1 APN 12 16708682 missense probably damaging 1.00
IGL02679:Greb1 APN 12 16708723 missense probably damaging 1.00
Humpback UTSW 12 16701171 missense probably damaging 1.00
IGL03048:Greb1 UTSW 12 16733331 missense probably damaging 1.00
R0083:Greb1 UTSW 12 16696451 missense probably benign
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0100:Greb1 UTSW 12 16680224 missense probably benign 0.41
R0220:Greb1 UTSW 12 16682286 missense probably damaging 1.00
R0245:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0540:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0547:Greb1 UTSW 12 16723411 missense probably benign
R0563:Greb1 UTSW 12 16680267 missense probably benign 0.23
R0607:Greb1 UTSW 12 16682193 missense probably damaging 1.00
R0610:Greb1 UTSW 12 16696442 missense probably benign
R0652:Greb1 UTSW 12 16696456 missense probably damaging 1.00
R0659:Greb1 UTSW 12 16680212 missense probably damaging 0.99
R0945:Greb1 UTSW 12 16673802 missense probably benign 0.31
R1055:Greb1 UTSW 12 16682251 missense probably damaging 0.98
R1445:Greb1 UTSW 12 16707851 missense probably damaging 1.00
R1471:Greb1 UTSW 12 16711774 missense probably damaging 0.97
R1503:Greb1 UTSW 12 16724819 nonsense probably null
R1614:Greb1 UTSW 12 16701171 missense probably damaging 1.00
R1623:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R1751:Greb1 UTSW 12 16723438 splice site probably benign
R1778:Greb1 UTSW 12 16690894 missense probably benign
R1842:Greb1 UTSW 12 16696243 missense probably damaging 1.00
R2040:Greb1 UTSW 12 16702650 missense probably damaging 1.00
R2153:Greb1 UTSW 12 16699532 missense probably damaging 1.00
R2178:Greb1 UTSW 12 16696387 missense probably damaging 1.00
R2194:Greb1 UTSW 12 16690908 missense probably benign 0.08
R2248:Greb1 UTSW 12 16680378 missense possibly damaging 0.90
R2474:Greb1 UTSW 12 16714953 missense possibly damaging 0.93
R2509:Greb1 UTSW 12 16724922 missense probably damaging 1.00
R2860:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2861:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2862:Greb1 UTSW 12 16711745 missense probably benign 0.28
R2866:Greb1 UTSW 12 16699550 missense probably damaging 1.00
R2890:Greb1 UTSW 12 16704478 missense probably damaging 1.00
R3056:Greb1 UTSW 12 16688591 missense probably damaging 0.96
R3863:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3864:Greb1 UTSW 12 16702420 missense probably damaging 1.00
R3956:Greb1 UTSW 12 16682299 missense probably damaging 1.00
R4493:Greb1 UTSW 12 16698610 missense probably benign 0.14
R4548:Greb1 UTSW 12 16699675 missense probably damaging 1.00
R4683:Greb1 UTSW 12 16711773 missense possibly damaging 0.75
R4739:Greb1 UTSW 12 16696328 missense probably damaging 1.00
R4770:Greb1 UTSW 12 16681356 missense probably benign 0.03
R4838:Greb1 UTSW 12 16684360 critical splice donor site probably null
R4925:Greb1 UTSW 12 16681471 missense probably damaging 1.00
R4982:Greb1 UTSW 12 16724761 missense probably damaging 0.98
R5009:Greb1 UTSW 12 16724857 missense possibly damaging 0.79
R5086:Greb1 UTSW 12 16708022 intron probably benign
R5213:Greb1 UTSW 12 16714790 nonsense probably null
R5310:Greb1 UTSW 12 16716759 missense probably benign 0.09
R5353:Greb1 UTSW 12 16688566 nonsense probably null
R5544:Greb1 UTSW 12 16673796 missense probably damaging 1.00
R5605:Greb1 UTSW 12 16708726 missense probably damaging 0.96
R5708:Greb1 UTSW 12 16673842 missense probably benign 0.11
R5837:Greb1 UTSW 12 16688585 missense probably damaging 1.00
R5890:Greb1 UTSW 12 16733421 missense possibly damaging 0.90
R5938:Greb1 UTSW 12 16717258 missense probably damaging 1.00
R6049:Greb1 UTSW 12 16681394 missense probably damaging 0.99
R6093:Greb1 UTSW 12 16684486 missense probably benign
R6120:Greb1 UTSW 12 16708621 missense probably damaging 0.99
R6175:Greb1 UTSW 12 16674770 missense probably damaging 1.00
R6247:Greb1 UTSW 12 16716675 missense probably damaging 1.00
R6274:Greb1 UTSW 12 16735151 missense probably damaging 0.97
R6376:Greb1 UTSW 12 16699579 missense probably damaging 0.97
R6523:Greb1 UTSW 12 16684373 missense possibly damaging 0.51
R6557:Greb1 UTSW 12 16710383 missense probably benign 0.00
R6602:Greb1 UTSW 12 16709440 missense probably benign 0.44
R6621:Greb1 UTSW 12 16692717 missense probably damaging 1.00
R6645:Greb1 UTSW 12 16698579 missense probably benign 0.07
R6725:Greb1 UTSW 12 16688567 missense probably damaging 1.00
R6750:Greb1 UTSW 12 16688583 missense probably benign 0.05
R6863:Greb1 UTSW 12 16684420 missense probably damaging 1.00
R6914:Greb1 UTSW 12 16707902 missense probably damaging 0.97
R6996:Greb1 UTSW 12 16723354 missense probably benign 0.00
R7083:Greb1 UTSW 12 16723314 missense not run
R7147:Greb1 UTSW 12 16733427 missense not run
Predicted Primers PCR Primer
(F):5'- CAGGACTCACCTGTGACAGCAATAC -3'
(R):5'- GTGCTGACATCATTTCTGTGCCACC -3'

Sequencing Primer
(F):5'- CTGTGACAGCAATACAGGAGTC -3'
(R):5'- ACCACCATGTCTTGCAGC -3'
Posted On2014-04-24