Incidental Mutation 'R1566:Tnfsf14'
ID 175310
Institutional Source Beutler Lab
Gene Symbol Tnfsf14
Ensembl Gene ENSMUSG00000005824
Gene Name tumor necrosis factor (ligand) superfamily, member 14
Synonyms LIGHT, HVEM-L
MMRRC Submission 039605-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R1566 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 57496492-57501177 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57500876 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000005976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005976]
AlphaFold Q9QYH9
Predicted Effect probably benign
Transcript: ENSMUST00000005976
AA Change: D65G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005976
Gene: ENSMUSG00000005824
AA Change: D65G

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 92 239 1.22e-49 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene leads to selective impairment of CD8+ T cell function. Mice homozygous for a knock-out allele exhibit defects in CD8+ T cell-mediated allogenic responses. Mice homozygous for a different knock-out allele show increased resistance to experimentally-induced hepatitis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T A 11: 109,679,632 (GRCm39) I247F probably benign Het
Afap1l1 T C 18: 61,888,714 (GRCm39) N119S probably benign Het
Ap2a1 T C 7: 44,552,904 (GRCm39) D721G probably benign Het
Ap3m2 C T 8: 23,293,967 (GRCm39) V28M probably damaging Het
Arhgef7 A G 8: 11,832,620 (GRCm39) T32A possibly damaging Het
Avl9 C T 6: 56,713,467 (GRCm39) R242* probably null Het
Bsn G A 9: 108,003,184 (GRCm39) T407I probably benign Het
Capn3 A T 2: 120,333,474 (GRCm39) R627S possibly damaging Het
Car13 G A 3: 14,715,758 (GRCm39) R92Q probably benign Het
Clcn1 T C 6: 42,268,374 (GRCm39) I149T possibly damaging Het
Col1a2 G T 6: 4,523,613 (GRCm39) G514V probably damaging Het
Ctsw C A 19: 5,515,445 (GRCm39) C347F probably damaging Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Eif1ad8 A T 12: 87,564,001 (GRCm39) H112L probably benign Het
Eml1 T A 12: 108,438,151 (GRCm39) V97D probably damaging Het
Epb41l1 A G 2: 156,363,879 (GRCm39) E796G probably benign Het
Gdnf A G 15: 7,863,895 (GRCm39) K102R probably benign Het
Gm1110 T C 9: 26,792,166 (GRCm39) E618G probably damaging Het
Gmnc T C 16: 26,782,689 (GRCm39) D22G probably damaging Het
Greb1 T C 12: 16,761,829 (GRCm39) D517G possibly damaging Het
Gsta1 A T 9: 78,149,741 (GRCm39) K185* probably null Het
Ift88 A G 14: 57,678,468 (GRCm39) D160G probably benign Het
Intu T A 3: 40,647,008 (GRCm39) I627N probably damaging Het
Itgav T A 2: 83,566,974 (GRCm39) F101L probably damaging Het
Kars1 C T 8: 112,724,290 (GRCm39) V475I probably benign Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Klra7 A G 6: 130,208,564 (GRCm39) V6A probably damaging Het
Krtap6-2 A G 16: 89,216,626 (GRCm39) S114P unknown Het
Ldlrad4 T C 18: 68,383,669 (GRCm39) S122P probably benign Het
Lig4 C A 8: 10,023,650 (GRCm39) L43F probably benign Het
Mfsd4a T C 1: 131,986,917 (GRCm39) D137G probably damaging Het
Mmel1 C T 4: 154,968,110 (GRCm39) R149C probably damaging Het
Morc2b T A 17: 33,355,948 (GRCm39) H608L probably benign Het
Mrgpra6 G A 7: 46,838,652 (GRCm39) T182I probably benign Het
Nat8l C A 5: 34,158,200 (GRCm39) N203K probably benign Het
Nin A T 12: 70,101,253 (GRCm39) V448E probably damaging Het
Or10a4 T G 7: 106,696,759 (GRCm39) F29C probably damaging Het
Or2m12 T A 16: 19,105,077 (GRCm39) M139L possibly damaging Het
Or5k15 T A 16: 58,709,903 (GRCm39) I227F probably damaging Het
Or8k21 G A 2: 86,145,129 (GRCm39) T167I probably benign Het
Pank4 T C 4: 155,064,978 (GRCm39) L759P probably damaging Het
Pcm1 T A 8: 41,743,810 (GRCm39) N1152K probably damaging Het
Pitpnm3 A T 11: 71,949,785 (GRCm39) probably null Het
Plekhg3 T C 12: 76,618,839 (GRCm39) M497T possibly damaging Het
Ppfia3 T C 7: 44,990,112 (GRCm39) D1138G probably damaging Het
Prl6a1 T A 13: 27,499,410 (GRCm39) S59R possibly damaging Het
Pth2r A G 1: 65,427,697 (GRCm39) S457G possibly damaging Het
Rbm25 T A 12: 83,721,828 (GRCm39) N671K probably damaging Het
Rbm26 T A 14: 105,397,980 (GRCm39) K47N unknown Het
Ryr1 T A 7: 28,791,600 (GRCm39) I1435F possibly damaging Het
Scin T A 12: 40,131,673 (GRCm39) H287L probably benign Het
Serpinb9e T C 13: 33,437,477 (GRCm39) L120P probably damaging Het
Slc34a1 A C 13: 55,559,844 (GRCm39) probably null Het
Slc39a10 A G 1: 46,875,245 (GRCm39) F19S possibly damaging Het
Sos1 A G 17: 80,761,345 (GRCm39) V117A probably damaging Het
Spta1 C A 1: 174,012,272 (GRCm39) N359K probably benign Het
Sspo G A 6: 48,443,804 (GRCm39) probably null Het
Stx5a T A 19: 8,719,675 (GRCm39) D13E probably damaging Het
Supt16 G A 14: 52,414,112 (GRCm39) A489V probably damaging Het
Tap1 T A 17: 34,408,520 (GRCm39) L253Q probably benign Het
Tmc6 A G 11: 117,660,262 (GRCm39) S659P probably damaging Het
Ttc28 G A 5: 111,373,543 (GRCm39) S962N probably damaging Het
Ugt8a T C 3: 125,669,207 (GRCm39) Y299C probably damaging Het
Upk1a A G 7: 30,309,145 (GRCm39) V59A possibly damaging Het
Usp38 T C 8: 81,711,432 (GRCm39) T868A probably benign Het
Wdsub1 G A 2: 59,707,059 (GRCm39) H58Y probably damaging Het
Zc3h7b T C 15: 81,653,035 (GRCm39) S19P possibly damaging Het
Zfp385b A C 2: 77,246,257 (GRCm39) F257V probably benign Het
Zmym4 A C 4: 126,804,940 (GRCm39) I188S possibly damaging Het
Other mutations in Tnfsf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Tnfsf14 APN 17 57,499,562 (GRCm39) missense possibly damaging 0.89
IGL00962:Tnfsf14 APN 17 57,499,906 (GRCm39) nonsense probably null
IGL02515:Tnfsf14 APN 17 57,499,600 (GRCm39) missense probably benign
P0015:Tnfsf14 UTSW 17 57,497,815 (GRCm39) missense probably damaging 1.00
R1435:Tnfsf14 UTSW 17 57,497,605 (GRCm39) missense possibly damaging 0.60
R1791:Tnfsf14 UTSW 17 57,497,867 (GRCm39) missense probably damaging 1.00
R1967:Tnfsf14 UTSW 17 57,497,807 (GRCm39) missense probably damaging 1.00
R2108:Tnfsf14 UTSW 17 57,497,867 (GRCm39) missense probably damaging 1.00
R2202:Tnfsf14 UTSW 17 57,497,638 (GRCm39) missense possibly damaging 0.67
R2203:Tnfsf14 UTSW 17 57,497,638 (GRCm39) missense possibly damaging 0.67
R2204:Tnfsf14 UTSW 17 57,497,638 (GRCm39) missense possibly damaging 0.67
R2205:Tnfsf14 UTSW 17 57,497,638 (GRCm39) missense possibly damaging 0.67
R2232:Tnfsf14 UTSW 17 57,500,876 (GRCm39) missense probably benign
R4790:Tnfsf14 UTSW 17 57,497,740 (GRCm39) missense probably damaging 1.00
R5434:Tnfsf14 UTSW 17 57,499,592 (GRCm39) missense probably benign 0.00
R7474:Tnfsf14 UTSW 17 57,497,848 (GRCm39) missense
R7691:Tnfsf14 UTSW 17 57,501,024 (GRCm39) missense possibly damaging 0.92
R8499:Tnfsf14 UTSW 17 57,497,534 (GRCm39) missense
R9330:Tnfsf14 UTSW 17 57,501,020 (GRCm39) missense probably damaging 1.00
Z1177:Tnfsf14 UTSW 17 57,501,089 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGACTCGGGAGCATACTGTGAC -3'
(R):5'- TGGACAGACGGACATCCCATTCAG -3'

Sequencing Primer
(F):5'- CATGGCTTGTCTGAAAGGAAC -3'
(R):5'- ATTCAGGCGGCTGGAAC -3'
Posted On 2014-04-24