Incidental Mutation 'R1567:Aox3'
ID175318
Institutional Source Beutler Lab
Gene Symbol Aox3
Ensembl Gene ENSMUSG00000064294
Gene Namealdehyde oxidase 3
SynonymsAOH1, 1200011D03Rik
MMRRC Submission 039606-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1567 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58113130-58200698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 58194693 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1285 (A1285E)
Ref Sequence ENSEMBL: ENSMUSP00000049391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040999]
PDB Structure
Crystal structure of the mouse liver Aldehyde Oxidase 3 (mAOX3) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040999
AA Change: A1285E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049391
Gene: ENSMUSG00000064294
AA Change: A1285E

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.4e-9 PFAM
Pfam:Fer2_2 91 165 1e-29 PFAM
Pfam:FAD_binding_5 239 419 1e-44 PFAM
CO_deh_flav_C 426 530 9.26e-24 SMART
Ald_Xan_dh_C 594 697 2.27e-41 SMART
Pfam:Ald_Xan_dh_C2 708 1241 8.7e-183 PFAM
low complexity region 1275 1286 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,431,129 V155I probably benign Het
Actrt2 T C 4: 154,666,914 Q255R possibly damaging Het
Adar A T 3: 89,735,781 H323L probably benign Het
Adgrg5 T A 8: 94,937,698 V312E probably damaging Het
Anapc1 T C 2: 128,617,716 T1808A probably damaging Het
Arhgap40 T A 2: 158,546,799 L551Q probably damaging Het
Blk A G 14: 63,380,729 S243P probably damaging Het
Cfap206 G T 4: 34,716,490 A325E probably benign Het
Cnn3 A T 3: 121,449,958 K23* probably null Het
Cog8 G A 8: 107,054,108 R173* probably null Het
Col11a1 G A 3: 114,138,612 R880H unknown Het
Cyp2c40 T C 19: 39,803,771 Q243R probably null Het
D11Wsu47e T A 11: 113,687,902 V41D probably damaging Het
Dcbld1 A G 10: 52,319,656 E391G probably damaging Het
Dchs1 C A 7: 105,771,861 A451S probably benign Het
Ddx43 A G 9: 78,416,709 K441E probably damaging Het
Depdc1a A T 3: 159,522,540 I310F possibly damaging Het
Dnah17 C T 11: 118,125,985 V247M probably damaging Het
Dtd1 G T 2: 144,747,025 G201V probably damaging Het
Enoph1 G A 5: 100,061,025 G80S probably benign Het
Fam76a A T 4: 132,917,728 Y48* probably null Het
Fut9 T G 4: 25,620,344 T157P probably damaging Het
Gm2016 A T 12: 87,876,984 I134F unknown Het
Gtpbp1 T C 15: 79,712,190 I310T probably damaging Het
Hk3 T A 13: 55,006,605 I753F probably damaging Het
Hnrnpl G T 7: 28,820,183 A419S possibly damaging Het
Ighv5-6 T C 12: 113,625,908 probably benign Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Kcnn2 T G 18: 45,670,334 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lmcd1 C T 6: 112,310,565 R71C probably damaging Het
Mrgprb1 A T 7: 48,447,453 V237E probably damaging Het
Mybl1 T A 1: 9,685,751 E191V probably damaging Het
Nbas T A 12: 13,285,278 F158I possibly damaging Het
Nbr1 C G 11: 101,575,211 L748V probably damaging Het
Nlrp10 G A 7: 108,927,050 T27M probably benign Het
Notch3 G A 17: 32,158,580 T174I possibly damaging Het
Nup85 T A 11: 115,568,398 I109K possibly damaging Het
Odf3b C A 15: 89,377,778 R137L probably benign Het
Olfr1255 T C 2: 89,817,184 L280P probably damaging Het
Olfr1298 G T 2: 111,645,926 Q24K possibly damaging Het
Olfr1367 A T 13: 21,347,425 I166L probably benign Het
Olfr138 A G 17: 38,275,568 I266V possibly damaging Het
Olfr1458 T C 19: 13,102,642 T221A probably benign Het
Olfr63 A G 17: 33,269,476 I251V probably benign Het
Phf2 T C 13: 48,832,113 K64E unknown Het
Polr2a T C 11: 69,746,031 T365A probably benign Het
Prkcd A G 14: 30,607,448 C12R probably benign Het
Ptprq T C 10: 107,565,887 I1915V probably benign Het
Rcbtb2 G A 14: 73,162,462 V112I probably benign Het
Rxfp3 A G 15: 11,036,101 V395A probably benign Het
Ryr2 C A 13: 11,759,677 G1198C possibly damaging Het
Scn1a T A 2: 66,273,331 I1851F probably damaging Het
Selenop A G 15: 3,279,698 *377W probably null Het
Sema4a A T 3: 88,452,046 C113S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Speg T C 1: 75,428,047 S2575P probably benign Het
Stk24 T A 14: 121,308,056 I97L probably benign Het
Tap2 A G 17: 34,214,091 K449R probably benign Het
Tecpr2 T A 12: 110,941,596 probably null Het
Ttn T A 2: 76,897,611 probably benign Het
Uggt2 A G 14: 119,009,093 F1204L possibly damaging Het
Ugt2b36 T C 5: 87,092,399 I42M probably damaging Het
Zdhhc8 A G 16: 18,227,120 L274P probably benign Het
Zfp974 C A 7: 27,910,723 D526Y probably damaging Het
Other mutations in Aox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Aox3 APN 1 58169794 missense probably damaging 1.00
IGL01747:Aox3 APN 1 58159658 missense probably damaging 0.97
IGL01883:Aox3 APN 1 58138283 missense probably damaging 1.00
IGL01911:Aox3 APN 1 58152560 missense probably benign 0.04
IGL02017:Aox3 APN 1 58120992 missense probably damaging 1.00
IGL02120:Aox3 APN 1 58127650 missense probably benign 0.00
IGL02466:Aox3 APN 1 58158272 missense probably benign 0.28
IGL02545:Aox3 APN 1 58183486 missense probably damaging 1.00
IGL02572:Aox3 APN 1 58158367 missense probably damaging 1.00
IGL02746:Aox3 APN 1 58183542 missense possibly damaging 0.83
IGL02808:Aox3 APN 1 58142700 missense probably damaging 0.99
IGL02812:Aox3 APN 1 58165896 missense probably benign 0.00
IGL02982:Aox3 APN 1 58127687 missense probably benign 0.00
IGL03056:Aox3 APN 1 58159021 critical splice donor site probably null
IGL03182:Aox3 APN 1 58165887 missense probably benign 0.02
IGL03234:Aox3 APN 1 58152686 missense probably benign
IGL03374:Aox3 APN 1 58171848 missense probably damaging 1.00
amber UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0071:Aox3 UTSW 1 58171891 nonsense probably null
R0135:Aox3 UTSW 1 58125088 splice site probably benign
R0332:Aox3 UTSW 1 58142751 missense probably benign 0.00
R0626:Aox3 UTSW 1 58172299 missense possibly damaging 0.94
R1325:Aox3 UTSW 1 58176567 nonsense probably null
R1435:Aox3 UTSW 1 58163446 critical splice donor site probably null
R1438:Aox3 UTSW 1 58153178 missense probably benign
R1575:Aox3 UTSW 1 58152554 missense probably benign 0.04
R1759:Aox3 UTSW 1 58170646 splice site probably null
R1785:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1786:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R1921:Aox3 UTSW 1 58180651 missense probably damaging 1.00
R1984:Aox3 UTSW 1 58153061 missense possibly damaging 0.88
R2012:Aox3 UTSW 1 58138232 missense probably benign 0.02
R2080:Aox3 UTSW 1 58186280 missense probably benign 0.06
R2121:Aox3 UTSW 1 58152549 splice site probably benign
R2126:Aox3 UTSW 1 58158216 missense probably benign 0.25
R2130:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2131:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2132:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2133:Aox3 UTSW 1 58169843 missense probably damaging 1.00
R2385:Aox3 UTSW 1 58138289 missense probably damaging 1.00
R2495:Aox3 UTSW 1 58188408 missense probably damaging 0.99
R4200:Aox3 UTSW 1 58188378 missense probably damaging 1.00
R4231:Aox3 UTSW 1 58114885 missense probably benign 0.12
R4591:Aox3 UTSW 1 58152656 missense probably damaging 0.99
R4627:Aox3 UTSW 1 58125035 missense probably damaging 0.98
R4831:Aox3 UTSW 1 58152566 missense probably damaging 0.97
R4864:Aox3 UTSW 1 58176487 missense probably damaging 1.00
R4976:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5007:Aox3 UTSW 1 58163424 missense probably benign
R5119:Aox3 UTSW 1 58188524 critical splice donor site probably null
R5175:Aox3 UTSW 1 58172328 missense probably benign 0.01
R5360:Aox3 UTSW 1 58146508 missense probably damaging 1.00
R5784:Aox3 UTSW 1 58153499 missense probably benign 0.00
R6050:Aox3 UTSW 1 58180655 missense possibly damaging 0.93
R6056:Aox3 UTSW 1 58169859 missense probably damaging 1.00
R6162:Aox3 UTSW 1 58159731 missense possibly damaging 0.75
R6181:Aox3 UTSW 1 58158946 missense probably benign 0.03
R6374:Aox3 UTSW 1 58172161 missense probably benign 0.11
R6662:Aox3 UTSW 1 58118615 missense probably damaging 1.00
R6809:Aox3 UTSW 1 58118681 missense probably damaging 0.99
R6810:Aox3 UTSW 1 58141431 missense probably benign 0.00
R6821:Aox3 UTSW 1 58150388 missense probably benign 0.04
R7039:Aox3 UTSW 1 58176555 missense probably damaging 1.00
R7116:Aox3 UTSW 1 58153530 missense probably benign 0.01
R7146:Aox3 UTSW 1 58158529 intron probably null
R7163:Aox3 UTSW 1 58119512 missense probably damaging 0.99
R7243:Aox3 UTSW 1 58138307 missense unknown
R7319:Aox3 UTSW 1 58152602 missense probably benign 0.04
R7423:Aox3 UTSW 1 58121069 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TATTCTTCCAGAGGGCCTACCCAC -3'
(R):5'- GTCCTGAAAAGGGTTGCAGACATGC -3'

Sequencing Primer
(F):5'- CTTCAGAAGCACGGGGTCAG -3'
(R):5'- GGTTGCAGACATGCATAGAC -3'
Posted On2014-04-24