Incidental Mutation 'R1567:Ryr2'
ID 175364
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Name ryanodine receptor 2, cardiac
Synonyms 9330127I20Rik
MMRRC Submission 039606-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1567 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 11567988-12121831 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 11774563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Cysteine at position 1198 (G1198C)
Ref Sequence ENSEMBL: ENSMUSP00000021750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]
AlphaFold no structure available at present
PDB Structure X-ray crystallography-solution NMR hybrid structure of mouse RyR2 domain A [SOLUTION NMR]
Crystal structure of mouse Ryanodine Receptor 2 (residues 1-217) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 mutant V186M [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 N-terminal domain (1-217) disease mutant A77V [X-RAY DIFFRACTION]
Structure of the first domain of a cardiac Ryanodine Receptor mutant with exon 3 deleted [X-RAY DIFFRACTION]
Crystal structure of mouse ryanodine receptor 2 (2699-2904) [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant P164S [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R169Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor 2 (1-217) disease mutant R176Q [X-RAY DIFFRACTION]
Crystal structure of mouse Ryanodine Receptor isoform 2 (RyR2) 1-547 [X-RAY DIFFRACTION]
>> 3 additional structures at PDB <<
Predicted Effect possibly damaging
Transcript: ENSMUST00000021750
AA Change: G1198C

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: G1198C

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170156
AA Change: G1198C

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: G1198C

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,030,352 (GRCm39) V155I probably benign Het
Actrt2 T C 4: 154,751,371 (GRCm39) Q255R possibly damaging Het
Adar A T 3: 89,643,088 (GRCm39) H323L probably benign Het
Adgrg5 T A 8: 95,664,326 (GRCm39) V312E probably damaging Het
Anapc1 T C 2: 128,459,636 (GRCm39) T1808A probably damaging Het
Aox3 C A 1: 58,233,852 (GRCm39) A1285E probably damaging Het
Arhgap40 T A 2: 158,388,719 (GRCm39) L551Q probably damaging Het
Blk A G 14: 63,618,178 (GRCm39) S243P probably damaging Het
Cfap206 G T 4: 34,716,490 (GRCm39) A325E probably benign Het
Cimap1b C A 15: 89,261,981 (GRCm39) R137L probably benign Het
Cnn3 A T 3: 121,243,607 (GRCm39) K23* probably null Het
Cog8 G A 8: 107,780,740 (GRCm39) R173* probably null Het
Col11a1 G A 3: 113,932,261 (GRCm39) R880H unknown Het
Cyp2c40 T C 19: 39,792,215 (GRCm39) Q243R probably null Het
Dcbld1 A G 10: 52,195,752 (GRCm39) E391G probably damaging Het
Dchs1 C A 7: 105,421,068 (GRCm39) A451S probably benign Het
Ddx43 A G 9: 78,323,991 (GRCm39) K441E probably damaging Het
Depdc1a A T 3: 159,228,177 (GRCm39) I310F possibly damaging Het
Dnah17 C T 11: 118,016,811 (GRCm39) V247M probably damaging Het
Dtd1 G T 2: 144,588,945 (GRCm39) G201V probably damaging Het
Eif1ad3 A T 12: 87,843,754 (GRCm39) I134F unknown Het
Enoph1 G A 5: 100,208,884 (GRCm39) G80S probably benign Het
Fam76a A T 4: 132,645,039 (GRCm39) Y48* probably null Het
Fut9 T G 4: 25,620,344 (GRCm39) T157P probably damaging Het
Gm57859 T A 11: 113,578,728 (GRCm39) V41D probably damaging Het
Gtpbp1 T C 15: 79,596,391 (GRCm39) I310T probably damaging Het
Hk3 T A 13: 55,154,418 (GRCm39) I753F probably damaging Het
Hnrnpl G T 7: 28,519,608 (GRCm39) A419S possibly damaging Het
Ighv5-6 T C 12: 113,589,528 (GRCm39) probably benign Het
Itpkb A G 1: 180,249,423 (GRCm39) T933A probably benign Het
Kcnn2 T G 18: 45,803,401 (GRCm39) probably null Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Lmcd1 C T 6: 112,287,526 (GRCm39) R71C probably damaging Het
Mrgprb1 A T 7: 48,097,201 (GRCm39) V237E probably damaging Het
Mybl1 T A 1: 9,755,976 (GRCm39) E191V probably damaging Het
Nbas T A 12: 13,335,279 (GRCm39) F158I possibly damaging Het
Nbr1 C G 11: 101,466,037 (GRCm39) L748V probably damaging Het
Nlrp10 G A 7: 108,526,257 (GRCm39) T27M probably benign Het
Notch3 G A 17: 32,377,554 (GRCm39) T174I possibly damaging Het
Nup85 T A 11: 115,459,224 (GRCm39) I109K possibly damaging Het
Or10h28 A G 17: 33,488,450 (GRCm39) I251V probably benign Het
Or2b28 A T 13: 21,531,595 (GRCm39) I166L probably benign Het
Or2n1e A G 17: 38,586,459 (GRCm39) I266V possibly damaging Het
Or4c12b T C 2: 89,647,528 (GRCm39) L280P probably damaging Het
Or4k48 G T 2: 111,476,271 (GRCm39) Q24K possibly damaging Het
Or5b105 T C 19: 13,080,006 (GRCm39) T221A probably benign Het
Phf2 T C 13: 48,985,589 (GRCm39) K64E unknown Het
Polr2a T C 11: 69,636,857 (GRCm39) T365A probably benign Het
Prkcd A G 14: 30,329,405 (GRCm39) C12R probably benign Het
Ptprq T C 10: 107,401,748 (GRCm39) I1915V probably benign Het
Rcbtb2 G A 14: 73,399,902 (GRCm39) V112I probably benign Het
Rxfp3 A G 15: 11,036,187 (GRCm39) V395A probably benign Het
Scn1a T A 2: 66,103,675 (GRCm39) I1851F probably damaging Het
Selenop A G 15: 3,309,180 (GRCm39) *377W probably null Het
Sema4a A T 3: 88,359,353 (GRCm39) C113S probably damaging Het
Sf3b1 C G 1: 55,058,554 (GRCm39) E12Q possibly damaging Het
Speg T C 1: 75,404,691 (GRCm39) S2575P probably benign Het
Stk24 T A 14: 121,545,468 (GRCm39) I97L probably benign Het
Tap2 A G 17: 34,433,065 (GRCm39) K449R probably benign Het
Tecpr2 T A 12: 110,908,030 (GRCm39) probably null Het
Ttn T A 2: 76,727,955 (GRCm39) probably benign Het
Uggt2 A G 14: 119,246,505 (GRCm39) F1204L possibly damaging Het
Ugt2b36 T C 5: 87,240,258 (GRCm39) I42M probably damaging Het
Zdhhc8 A G 16: 18,044,984 (GRCm39) L274P probably benign Het
Zfp974 C A 7: 27,610,148 (GRCm39) D526Y probably damaging Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11,848,978 (GRCm39) splice site probably benign
IGL00757:Ryr2 APN 13 11,633,490 (GRCm39) splice site probably null
IGL00838:Ryr2 APN 13 11,583,389 (GRCm39) missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11,600,364 (GRCm39) missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11,750,388 (GRCm39) missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11,718,430 (GRCm39) missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11,653,371 (GRCm39) critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11,602,125 (GRCm39) missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11,571,571 (GRCm39) missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11,606,238 (GRCm39) missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11,756,922 (GRCm39) missense probably benign 0.10
IGL01419:Ryr2 APN 13 11,814,723 (GRCm39) missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11,866,090 (GRCm39) missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11,736,676 (GRCm39) missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11,736,647 (GRCm39) missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11,616,644 (GRCm39) critical splice donor site probably null
IGL01611:Ryr2 APN 13 11,606,202 (GRCm39) missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11,609,854 (GRCm39) missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11,707,563 (GRCm39) missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11,600,366 (GRCm39) missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11,616,728 (GRCm39) missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11,610,311 (GRCm39) missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11,569,436 (GRCm39) missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11,805,249 (GRCm39) missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11,611,998 (GRCm39) missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11,762,450 (GRCm39) missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11,587,143 (GRCm39) missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11,807,648 (GRCm39) nonsense probably null
IGL02086:Ryr2 APN 13 11,750,442 (GRCm39) missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11,774,645 (GRCm39) missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11,752,759 (GRCm39) missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11,756,755 (GRCm39) missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11,745,274 (GRCm39) missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11,762,544 (GRCm39) splice site probably benign
IGL02369:Ryr2 APN 13 11,634,382 (GRCm39) missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11,737,607 (GRCm39) splice site probably benign
IGL02400:Ryr2 APN 13 11,620,130 (GRCm39) splice site probably benign
IGL02423:Ryr2 APN 13 11,760,084 (GRCm39) missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11,760,560 (GRCm39) missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11,720,585 (GRCm39) missense probably benign 0.15
IGL02602:Ryr2 APN 13 11,569,397 (GRCm39) utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11,620,075 (GRCm39) missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11,753,206 (GRCm39) missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11,670,563 (GRCm39) missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11,610,076 (GRCm39) missense probably benign 0.21
IGL02876:Ryr2 APN 13 11,722,679 (GRCm39) missense probably benign 0.39
IGL02878:Ryr2 APN 13 11,933,205 (GRCm39) missense probably benign 0.10
IGL02887:Ryr2 APN 13 11,606,155 (GRCm39) missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11,774,721 (GRCm39) missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11,699,365 (GRCm39) missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11,658,788 (GRCm39) critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11,650,468 (GRCm39) splice site probably benign
IGL03152:Ryr2 APN 13 11,868,036 (GRCm39) missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11,756,909 (GRCm39) nonsense probably null
IGL03180:Ryr2 APN 13 11,583,449 (GRCm39) missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11,739,273 (GRCm39) splice site probably benign
IGL03390:Ryr2 APN 13 11,787,302 (GRCm39) missense probably benign
IGL03410:Ryr2 APN 13 11,603,033 (GRCm39) missense probably damaging 0.99
Arruda UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
Arruda2 UTSW 13 11,894,382 (GRCm39) missense probably damaging 1.00
Arruda3 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
barricuda UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
BB006:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB006:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
BB016:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
BB016:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
H8562:Ryr2 UTSW 13 11,732,027 (GRCm39) splice site probably benign
IGL02799:Ryr2 UTSW 13 11,680,848 (GRCm39) missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11,776,192 (GRCm39) missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11,722,682 (GRCm39) missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11,609,641 (GRCm39) missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11,570,334 (GRCm39) missense probably benign 0.29
R0003:Ryr2 UTSW 13 11,839,265 (GRCm39) missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11,680,805 (GRCm39) missense probably benign
R0018:Ryr2 UTSW 13 11,610,109 (GRCm39) missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11,610,670 (GRCm39) missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11,683,924 (GRCm39) missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0062:Ryr2 UTSW 13 11,884,002 (GRCm39) critical splice donor site probably null
R0080:Ryr2 UTSW 13 11,583,361 (GRCm39) missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11,724,807 (GRCm39) missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11,729,434 (GRCm39) missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11,691,137 (GRCm39) splice site probably benign
R0226:Ryr2 UTSW 13 11,787,442 (GRCm39) missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11,731,863 (GRCm39) missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11,683,725 (GRCm39) missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11,720,570 (GRCm39) missense probably benign 0.45
R0415:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11,848,981 (GRCm39) splice site probably benign
R0558:Ryr2 UTSW 13 11,814,747 (GRCm39) missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11,653,329 (GRCm39) missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11,746,555 (GRCm39) missense probably benign 0.02
R0586:Ryr2 UTSW 13 11,650,445 (GRCm39) missense probably null
R0601:Ryr2 UTSW 13 11,720,519 (GRCm39) critical splice donor site probably null
R0610:Ryr2 UTSW 13 11,637,838 (GRCm39) missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11,739,219 (GRCm39) missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11,581,771 (GRCm39) missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11,753,012 (GRCm39) missense probably benign 0.35
R0884:Ryr2 UTSW 13 11,569,415 (GRCm39) missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11,684,855 (GRCm39) missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11,960,867 (GRCm39) missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11,674,999 (GRCm39) missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11,897,929 (GRCm39) critical splice donor site probably null
R1296:Ryr2 UTSW 13 11,702,765 (GRCm39) splice site probably benign
R1400:Ryr2 UTSW 13 11,609,962 (GRCm39) missense probably benign 0.08
R1439:Ryr2 UTSW 13 11,729,389 (GRCm39) splice site probably benign
R1443:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R1446:Ryr2 UTSW 13 11,753,035 (GRCm39) missense probably benign 0.09
R1458:Ryr2 UTSW 13 11,741,908 (GRCm39) missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11,616,727 (GRCm39) missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11,569,478 (GRCm39) missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11,569,435 (GRCm39) nonsense probably null
R1551:Ryr2 UTSW 13 11,800,029 (GRCm39) critical splice acceptor site probably null
R1581:Ryr2 UTSW 13 11,809,449 (GRCm39) missense probably benign 0.01
R1645:Ryr2 UTSW 13 11,733,368 (GRCm39) nonsense probably null
R1686:Ryr2 UTSW 13 11,618,665 (GRCm39) splice site probably benign
R1696:Ryr2 UTSW 13 11,746,543 (GRCm39) missense probably benign 0.02
R1708:Ryr2 UTSW 13 11,602,328 (GRCm39) splice site probably null
R1728:Ryr2 UTSW 13 11,602,308 (GRCm39) missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11,805,153 (GRCm39) missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1776:Ryr2 UTSW 13 11,760,062 (GRCm39) critical splice donor site probably null
R1783:Ryr2 UTSW 13 11,715,257 (GRCm39) nonsense probably null
R1801:Ryr2 UTSW 13 11,610,167 (GRCm39) missense probably benign 0.01
R1812:Ryr2 UTSW 13 11,575,472 (GRCm39) missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11,602,202 (GRCm39) missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11,784,764 (GRCm39) missense probably benign 0.06
R1868:Ryr2 UTSW 13 11,746,586 (GRCm39) missense probably benign 0.02
R1869:Ryr2 UTSW 13 11,676,961 (GRCm39) missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11,753,242 (GRCm39) missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11,673,844 (GRCm39) nonsense probably null
R1897:Ryr2 UTSW 13 11,765,818 (GRCm39) missense probably benign 0.09
R1899:Ryr2 UTSW 13 11,606,222 (GRCm39) missense probably benign
R1909:Ryr2 UTSW 13 11,715,235 (GRCm39) missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11,571,584 (GRCm39) missense possibly damaging 0.91
R1937:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R1943:Ryr2 UTSW 13 11,746,609 (GRCm39) missense probably benign 0.10
R1956:Ryr2 UTSW 13 11,695,966 (GRCm39) missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11,600,288 (GRCm39) splice site probably null
R2018:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11,866,074 (GRCm39) missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11,610,622 (GRCm39) missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11,680,764 (GRCm39) splice site probably null
R2088:Ryr2 UTSW 13 11,677,115 (GRCm39) missense probably benign 0.04
R2089:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2091:Ryr2 UTSW 13 11,960,863 (GRCm39) missense probably benign 0.23
R2127:Ryr2 UTSW 13 11,727,081 (GRCm39) missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11,575,493 (GRCm39) missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11,592,759 (GRCm39) missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11,720,679 (GRCm39) nonsense probably null
R2207:Ryr2 UTSW 13 11,825,823 (GRCm39) missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11,677,146 (GRCm39) missense probably benign 0.18
R2258:Ryr2 UTSW 13 11,753,102 (GRCm39) missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11,753,128 (GRCm39) missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11,606,123 (GRCm39) missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11,816,734 (GRCm39) missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11,774,589 (GRCm39) missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11,607,979 (GRCm39) missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11,776,235 (GRCm39) missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11,787,466 (GRCm39) critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11,603,045 (GRCm39) missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11,753,095 (GRCm39) missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11,787,313 (GRCm39) missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11,933,300 (GRCm39) missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11,707,568 (GRCm39) missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11,794,153 (GRCm39) missense probably benign 0.22
R4127:Ryr2 UTSW 13 11,602,323 (GRCm39) missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11,752,759 (GRCm39) missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11,765,611 (GRCm39) missense probably benign 0.20
R4355:Ryr2 UTSW 13 11,664,698 (GRCm39) missense probably benign 0.05
R4384:Ryr2 UTSW 13 11,620,119 (GRCm39) missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11,731,952 (GRCm39) nonsense probably null
R4430:Ryr2 UTSW 13 11,750,413 (GRCm39) missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12,121,301 (GRCm39) missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11,764,395 (GRCm39) missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11,765,571 (GRCm39) splice site probably null
R4668:Ryr2 UTSW 13 11,608,003 (GRCm39) missense probably benign
R4677:Ryr2 UTSW 13 11,721,553 (GRCm39) missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11,839,255 (GRCm39) missense probably benign 0.34
R4680:Ryr2 UTSW 13 11,610,119 (GRCm39) missense probably benign 0.04
R4685:Ryr2 UTSW 13 11,707,532 (GRCm39) missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11,731,884 (GRCm39) missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11,592,795 (GRCm39) missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11,752,639 (GRCm39) missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11,671,933 (GRCm39) missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,702,818 (GRCm39) missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11,723,113 (GRCm39) missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11,731,983 (GRCm39) missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11,670,584 (GRCm39) missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11,760,638 (GRCm39) missense probably damaging 1.00
R4850:Ryr2 UTSW 13 11,683,706 (GRCm39) missense probably damaging 0.99
R4880:Ryr2 UTSW 13 11,767,104 (GRCm39) missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11,609,872 (GRCm39) missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11,724,849 (GRCm39) missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11,960,831 (GRCm39) missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11,756,897 (GRCm39) missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11,799,966 (GRCm39) missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4964:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,729,497 (GRCm39) missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11,848,878 (GRCm39) missense probably benign 0.00
R4997:Ryr2 UTSW 13 11,610,192 (GRCm39) missense probably benign 0.09
R4998:Ryr2 UTSW 13 11,658,781 (GRCm39) missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11,602,140 (GRCm39) missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11,650,422 (GRCm39) missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11,715,240 (GRCm39) missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11,727,129 (GRCm39) nonsense probably null
R5135:Ryr2 UTSW 13 11,677,016 (GRCm39) missense probably benign 0.05
R5138:Ryr2 UTSW 13 11,675,175 (GRCm39) missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11,767,207 (GRCm39) missense probably benign
R5187:Ryr2 UTSW 13 11,787,338 (GRCm39) missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11,653,316 (GRCm39) critical splice donor site probably null
R5262:Ryr2 UTSW 13 11,787,323 (GRCm39) missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11,705,249 (GRCm39) missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11,571,544 (GRCm39) missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11,720,542 (GRCm39) missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11,720,587 (GRCm39) missense probably null 0.15
R5509:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11,702,795 (GRCm39) missense probably benign 0.01
R5571:Ryr2 UTSW 13 11,570,334 (GRCm39) missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11,609,900 (GRCm39) missense probably benign 0.06
R5619:Ryr2 UTSW 13 11,723,088 (GRCm39) missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11,616,691 (GRCm39) missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11,610,468 (GRCm39) missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11,774,722 (GRCm39) missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11,784,848 (GRCm39) missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11,575,460 (GRCm39) missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11,599,040 (GRCm39) missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11,805,218 (GRCm39) missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11,702,788 (GRCm39) missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11,675,008 (GRCm39) missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11,741,839 (GRCm39) missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11,677,124 (GRCm39) nonsense probably null
R5974:Ryr2 UTSW 13 11,729,397 (GRCm39) splice site probably null
R6104:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11,807,575 (GRCm39) missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11,683,903 (GRCm39) missense probably benign
R6208:Ryr2 UTSW 13 11,910,106 (GRCm39) missense probably benign 0.04
R6217:Ryr2 UTSW 13 11,848,964 (GRCm39) missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11,674,993 (GRCm39) missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11,894,382 (GRCm39) missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11,776,282 (GRCm39) missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11,677,269 (GRCm39) missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11,848,893 (GRCm39) missense probably benign 0.29
R6548:Ryr2 UTSW 13 11,683,707 (GRCm39) missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6623:Ryr2 UTSW 13 11,724,951 (GRCm39) missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11,610,529 (GRCm39) missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11,609,609 (GRCm39) missense probably benign 0.01
R6770:Ryr2 UTSW 13 11,753,348 (GRCm39) missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11,701,852 (GRCm39) missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11,741,816 (GRCm39) missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11,844,540 (GRCm39) missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11,842,445 (GRCm39) missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11,760,487 (GRCm39) missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11,581,834 (GRCm39) missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11,816,129 (GRCm39) missense probably benign 0.28
R6997:Ryr2 UTSW 13 11,669,266 (GRCm39) missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11,727,052 (GRCm39) missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11,809,491 (GRCm39) missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11,839,286 (GRCm39) missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11,664,662 (GRCm39) missense probably benign 0.10
R7125:Ryr2 UTSW 13 11,684,873 (GRCm39) missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11,670,599 (GRCm39) missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11,683,697 (GRCm39) critical splice donor site probably null
R7131:Ryr2 UTSW 13 11,655,213 (GRCm39) missense possibly damaging 0.63
R7159:Ryr2 UTSW 13 11,825,794 (GRCm39) missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11,816,063 (GRCm39) missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11,701,864 (GRCm39) missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11,774,643 (GRCm39) missense probably benign
R7189:Ryr2 UTSW 13 11,898,009 (GRCm39) missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11,680,799 (GRCm39) missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11,612,032 (GRCm39) missense probably damaging 1.00
R7326:Ryr2 UTSW 13 11,753,080 (GRCm39) missense possibly damaging 0.95
R7331:Ryr2 UTSW 13 11,760,517 (GRCm39) missense probably benign
R7365:Ryr2 UTSW 13 11,655,161 (GRCm39) missense probably damaging 0.99
R7372:Ryr2 UTSW 13 11,695,885 (GRCm39) missense probably damaging 0.97
R7395:Ryr2 UTSW 13 11,799,997 (GRCm39) missense probably damaging 0.98
R7404:Ryr2 UTSW 13 11,750,506 (GRCm39) missense probably damaging 0.97
R7417:Ryr2 UTSW 13 11,571,634 (GRCm39) splice site probably null
R7425:Ryr2 UTSW 13 11,720,530 (GRCm39) missense probably benign 0.20
R7444:Ryr2 UTSW 13 11,570,349 (GRCm39) missense probably benign 0.25
R7456:Ryr2 UTSW 13 11,767,168 (GRCm39) missense probably benign
R7460:Ryr2 UTSW 13 11,720,596 (GRCm39) missense probably benign 0.10
R7474:Ryr2 UTSW 13 11,609,762 (GRCm39) missense probably benign 0.04
R7543:Ryr2 UTSW 13 11,653,317 (GRCm39) critical splice donor site probably null
R7549:Ryr2 UTSW 13 11,752,871 (GRCm39) missense probably benign 0.15
R7558:Ryr2 UTSW 13 11,814,711 (GRCm39) missense probably damaging 1.00
R7565:Ryr2 UTSW 13 11,575,539 (GRCm39) missense possibly damaging 0.84
R7627:Ryr2 UTSW 13 11,776,213 (GRCm39) missense possibly damaging 0.65
R7698:Ryr2 UTSW 13 11,776,201 (GRCm39) missense possibly damaging 0.94
R7702:Ryr2 UTSW 13 11,705,219 (GRCm39) missense probably damaging 0.99
R7719:Ryr2 UTSW 13 11,745,229 (GRCm39) missense possibly damaging 0.94
R7772:Ryr2 UTSW 13 11,765,897 (GRCm39) missense probably benign
R7797:Ryr2 UTSW 13 11,816,066 (GRCm39) missense probably damaging 0.99
R7829:Ryr2 UTSW 13 11,842,493 (GRCm39) missense possibly damaging 0.81
R7855:Ryr2 UTSW 13 11,721,509 (GRCm39) nonsense probably null
R7872:Ryr2 UTSW 13 11,610,610 (GRCm39) missense probably damaging 1.00
R7908:Ryr2 UTSW 13 11,807,634 (GRCm39) missense probably benign 0.01
R7929:Ryr2 UTSW 13 11,609,680 (GRCm39) missense probably damaging 1.00
R7929:Ryr2 UTSW 13 11,705,181 (GRCm39) nonsense probably null
R7952:Ryr2 UTSW 13 11,661,313 (GRCm39) splice site probably null
R8008:Ryr2 UTSW 13 11,671,980 (GRCm39) missense probably benign 0.30
R8011:Ryr2 UTSW 13 11,603,026 (GRCm39) critical splice donor site probably null
R8097:Ryr2 UTSW 13 11,960,881 (GRCm39) missense probably damaging 0.98
R8133:Ryr2 UTSW 13 11,618,584 (GRCm39) missense probably damaging 1.00
R8253:Ryr2 UTSW 13 11,842,439 (GRCm39) missense possibly damaging 0.94
R8278:Ryr2 UTSW 13 11,610,392 (GRCm39) nonsense probably null
R8351:Ryr2 UTSW 13 11,814,718 (GRCm39) missense probably damaging 0.98
R8401:Ryr2 UTSW 13 11,683,821 (GRCm39) missense possibly damaging 0.95
R8403:Ryr2 UTSW 13 11,699,364 (GRCm39) missense possibly damaging 0.95
R8431:Ryr2 UTSW 13 11,673,894 (GRCm39) missense probably benign 0.00
R8509:Ryr2 UTSW 13 11,592,664 (GRCm39) critical splice donor site probably null
R8551:Ryr2 UTSW 13 11,575,479 (GRCm39) missense possibly damaging 0.93
R8684:Ryr2 UTSW 13 11,702,875 (GRCm39) missense probably damaging 0.99
R8735:Ryr2 UTSW 13 11,701,833 (GRCm39) missense probably damaging 0.97
R8766:Ryr2 UTSW 13 11,683,855 (GRCm39) missense probably damaging 0.97
R8817:Ryr2 UTSW 13 11,750,509 (GRCm39) missense possibly damaging 0.95
R8827:Ryr2 UTSW 13 11,572,934 (GRCm39) missense possibly damaging 0.80
R8884:Ryr2 UTSW 13 11,794,152 (GRCm39) missense probably benign 0.19
R8889:Ryr2 UTSW 13 11,799,990 (GRCm39) missense probably damaging 0.99
R8891:Ryr2 UTSW 13 11,814,768 (GRCm39) missense probably damaging 1.00
R8979:Ryr2 UTSW 13 11,609,924 (GRCm39) missense probably benign 0.00
R9013:Ryr2 UTSW 13 11,618,618 (GRCm39) missense probably damaging 0.98
R9040:Ryr2 UTSW 13 11,609,672 (GRCm39) missense probably damaging 0.97
R9044:Ryr2 UTSW 13 11,752,989 (GRCm39) nonsense probably null
R9056:Ryr2 UTSW 13 11,610,817 (GRCm39) missense possibly damaging 0.94
R9084:Ryr2 UTSW 13 11,616,724 (GRCm39) missense probably damaging 1.00
R9113:Ryr2 UTSW 13 11,618,741 (GRCm39) intron probably benign
R9116:Ryr2 UTSW 13 11,587,185 (GRCm39) missense possibly damaging 0.93
R9125:Ryr2 UTSW 13 11,669,292 (GRCm39) missense probably benign 0.28
R9148:Ryr2 UTSW 13 11,900,424 (GRCm39) missense probably benign 0.02
R9210:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9212:Ryr2 UTSW 13 11,844,560 (GRCm39) missense probably damaging 0.99
R9233:Ryr2 UTSW 13 11,610,772 (GRCm39) missense possibly damaging 0.77
R9254:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9262:Ryr2 UTSW 13 11,765,854 (GRCm39) missense probably damaging 0.97
R9275:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9278:Ryr2 UTSW 13 11,897,976 (GRCm39) missense probably benign 0.10
R9309:Ryr2 UTSW 13 11,721,578 (GRCm39) missense probably damaging 0.99
R9379:Ryr2 UTSW 13 11,898,002 (GRCm39) missense probably damaging 1.00
R9409:Ryr2 UTSW 13 11,695,973 (GRCm39) missense probably damaging 0.99
R9429:Ryr2 UTSW 13 11,809,459 (GRCm39) missense probably damaging 0.97
R9445:Ryr2 UTSW 13 11,787,463 (GRCm39) missense probably damaging 1.00
R9464:Ryr2 UTSW 13 11,752,680 (GRCm39) missense probably benign 0.00
R9467:Ryr2 UTSW 13 11,571,490 (GRCm39) missense possibly damaging 0.70
R9546:Ryr2 UTSW 13 11,602,101 (GRCm39) critical splice donor site probably null
R9562:Ryr2 UTSW 13 11,760,104 (GRCm39) missense probably damaging 1.00
R9609:Ryr2 UTSW 13 11,683,848 (GRCm39) missense probably damaging 1.00
R9704:Ryr2 UTSW 13 11,737,646 (GRCm39) missense probably damaging 1.00
R9764:Ryr2 UTSW 13 11,701,935 (GRCm39) missense possibly damaging 0.67
R9772:Ryr2 UTSW 13 11,609,785 (GRCm39) missense probably benign 0.13
R9776:Ryr2 UTSW 13 11,707,599 (GRCm39) missense probably damaging 0.98
S24628:Ryr2 UTSW 13 11,884,042 (GRCm39) missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11,718,387 (GRCm39) missense probably benign 0.04
Z1176:Ryr2 UTSW 13 11,658,689 (GRCm39) critical splice donor site probably null
Z1176:Ryr2 UTSW 13 11,613,497 (GRCm39) critical splice acceptor site probably null
Z1176:Ryr2 UTSW 13 11,809,435 (GRCm39) nonsense probably null
Z1177:Ryr2 UTSW 13 11,765,759 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTTCTGCTGTACACACAGACACCC -3'
(R):5'- TTTATCCCCAGCCTGGCACTAGAC -3'

Sequencing Primer
(F):5'- ACGTAAGTAGGGTAGGTGTCATTTC -3'
(R):5'- CACTAGACTGGTAGTTCCAACTGAG -3'
Posted On 2014-04-24