Incidental Mutation 'R1567:Hk3'
ID175367
Institutional Source Beutler Lab
Gene Symbol Hk3
Ensembl Gene ENSMUSG00000025877
Gene Namehexokinase 3
Synonyms
MMRRC Submission 039606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1567 (G1)
Quality Score156
Status Not validated
Chromosome13
Chromosomal Location55005985-55021385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55006605 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 753 (I753F)
Ref Sequence ENSEMBL: ENSMUSP00000115227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026994] [ENSMUST00000052949] [ENSMUST00000109994] [ENSMUST00000123097] [ENSMUST00000126234] [ENSMUST00000132309] [ENSMUST00000137967] [ENSMUST00000153665]
Predicted Effect probably benign
Transcript: ENSMUST00000026994
SMART Domains Protein: ENSMUSP00000026994
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 296 1.25e-14 SMART
TSP1 301 350 1.98e-8 SMART
transmembrane domain 360 382 N/A INTRINSIC
ZU5 495 598 3.68e-58 SMART
DEATH 805 896 5.86e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000052949
AA Change: I808F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051215
Gene: ENSMUSG00000025877
AA Change: I808F

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.7e-76 PFAM
Pfam:Hexokinase_2 234 473 1.9e-87 PFAM
Pfam:Hexokinase_1 475 674 2.2e-77 PFAM
Pfam:Hexokinase_2 676 915 2.3e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109994
SMART Domains Protein: ENSMUSP00000105621
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1biha1 44 143 1e-4 SMART
IG 155 240 1.8e-5 SMART
TSP1 245 294 1.98e-8 SMART
transmembrane domain 305 327 N/A INTRINSIC
ZU5 439 542 3.68e-58 SMART
DEATH 749 840 5.86e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123097
AA Change: I763F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116717
Gene: ENSMUSG00000025877
AA Change: I763F

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 232 3.3e-77 PFAM
Pfam:Hexokinase_2 234 457 6e-74 PFAM
Pfam:Hexokinase_1 430 629 3e-78 PFAM
Pfam:Hexokinase_2 631 870 1e-104 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126234
AA Change: I808F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123233
Gene: ENSMUSG00000025877
AA Change: I808F

DomainStartEndE-ValueType
Pfam:Hexokinase_1 31 230 2.4e-63 PFAM
Pfam:Hexokinase_2 236 470 2.9e-62 PFAM
Pfam:Hexokinase_1 480 673 2e-69 PFAM
Pfam:Hexokinase_2 678 912 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132309
SMART Domains Protein: ENSMUSP00000117254
Gene: ENSMUSG00000025877

DomainStartEndE-ValueType
Pfam:Hexokinase_1 29 164 4.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137967
SMART Domains Protein: ENSMUSP00000115531
Gene: ENSMUSG00000025876

DomainStartEndE-ValueType
PDB:3G5B|A 1 118 6e-36 PDB
Blast:DEATH 80 119 9e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142906
Predicted Effect probably damaging
Transcript: ENSMUST00000153665
AA Change: I753F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115227
Gene: ENSMUSG00000025877
AA Change: I753F

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 177 8.5e-70 PFAM
Pfam:Hexokinase_2 179 418 9.4e-88 PFAM
Pfam:Hexokinase_1 420 619 1.2e-77 PFAM
Pfam:Hexokinase_2 621 860 1.1e-103 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 3. Similar to hexokinases 1 and 2, this allosteric enzyme is inhibited by its product glucose-6-phosphate. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,431,129 V155I probably benign Het
Actrt2 T C 4: 154,666,914 Q255R possibly damaging Het
Adar A T 3: 89,735,781 H323L probably benign Het
Adgrg5 T A 8: 94,937,698 V312E probably damaging Het
Anapc1 T C 2: 128,617,716 T1808A probably damaging Het
Aox3 C A 1: 58,194,693 A1285E probably damaging Het
Arhgap40 T A 2: 158,546,799 L551Q probably damaging Het
Blk A G 14: 63,380,729 S243P probably damaging Het
Cfap206 G T 4: 34,716,490 A325E probably benign Het
Cnn3 A T 3: 121,449,958 K23* probably null Het
Cog8 G A 8: 107,054,108 R173* probably null Het
Col11a1 G A 3: 114,138,612 R880H unknown Het
Cyp2c40 T C 19: 39,803,771 Q243R probably null Het
D11Wsu47e T A 11: 113,687,902 V41D probably damaging Het
Dcbld1 A G 10: 52,319,656 E391G probably damaging Het
Dchs1 C A 7: 105,771,861 A451S probably benign Het
Ddx43 A G 9: 78,416,709 K441E probably damaging Het
Depdc1a A T 3: 159,522,540 I310F possibly damaging Het
Dnah17 C T 11: 118,125,985 V247M probably damaging Het
Dtd1 G T 2: 144,747,025 G201V probably damaging Het
Enoph1 G A 5: 100,061,025 G80S probably benign Het
Fam76a A T 4: 132,917,728 Y48* probably null Het
Fut9 T G 4: 25,620,344 T157P probably damaging Het
Gm2016 A T 12: 87,876,984 I134F unknown Het
Gtpbp1 T C 15: 79,712,190 I310T probably damaging Het
Hnrnpl G T 7: 28,820,183 A419S possibly damaging Het
Ighv5-6 T C 12: 113,625,908 probably benign Het
Itpkb A G 1: 180,421,858 T933A probably benign Het
Kcnn2 T G 18: 45,670,334 probably null Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lmcd1 C T 6: 112,310,565 R71C probably damaging Het
Mrgprb1 A T 7: 48,447,453 V237E probably damaging Het
Mybl1 T A 1: 9,685,751 E191V probably damaging Het
Nbas T A 12: 13,285,278 F158I possibly damaging Het
Nbr1 C G 11: 101,575,211 L748V probably damaging Het
Nlrp10 G A 7: 108,927,050 T27M probably benign Het
Notch3 G A 17: 32,158,580 T174I possibly damaging Het
Nup85 T A 11: 115,568,398 I109K possibly damaging Het
Odf3b C A 15: 89,377,778 R137L probably benign Het
Olfr1255 T C 2: 89,817,184 L280P probably damaging Het
Olfr1298 G T 2: 111,645,926 Q24K possibly damaging Het
Olfr1367 A T 13: 21,347,425 I166L probably benign Het
Olfr138 A G 17: 38,275,568 I266V possibly damaging Het
Olfr1458 T C 19: 13,102,642 T221A probably benign Het
Olfr63 A G 17: 33,269,476 I251V probably benign Het
Phf2 T C 13: 48,832,113 K64E unknown Het
Polr2a T C 11: 69,746,031 T365A probably benign Het
Prkcd A G 14: 30,607,448 C12R probably benign Het
Ptprq T C 10: 107,565,887 I1915V probably benign Het
Rcbtb2 G A 14: 73,162,462 V112I probably benign Het
Rxfp3 A G 15: 11,036,101 V395A probably benign Het
Ryr2 C A 13: 11,759,677 G1198C possibly damaging Het
Scn1a T A 2: 66,273,331 I1851F probably damaging Het
Selenop A G 15: 3,279,698 *377W probably null Het
Sema4a A T 3: 88,452,046 C113S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Speg T C 1: 75,428,047 S2575P probably benign Het
Stk24 T A 14: 121,308,056 I97L probably benign Het
Tap2 A G 17: 34,214,091 K449R probably benign Het
Tecpr2 T A 12: 110,941,596 probably null Het
Ttn T A 2: 76,897,611 probably benign Het
Uggt2 A G 14: 119,009,093 F1204L possibly damaging Het
Ugt2b36 T C 5: 87,092,399 I42M probably damaging Het
Zdhhc8 A G 16: 18,227,120 L274P probably benign Het
Zfp974 C A 7: 27,910,723 D526Y probably damaging Het
Other mutations in Hk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Hk3 APN 13 55014426 critical splice donor site probably null
IGL01314:Hk3 APN 13 55007063 splice site probably benign
IGL02043:Hk3 APN 13 55015095 missense probably damaging 1.00
IGL02197:Hk3 APN 13 55014468 missense probably damaging 1.00
IGL02619:Hk3 APN 13 55014294 missense probably damaging 1.00
R0454:Hk3 UTSW 13 55008705 missense probably damaging 1.00
R0518:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0521:Hk3 UTSW 13 55014426 critical splice donor site probably null
R0709:Hk3 UTSW 13 55014730 missense probably damaging 1.00
R1386:Hk3 UTSW 13 55007030 intron probably null
R1647:Hk3 UTSW 13 55014461 missense probably damaging 1.00
R1648:Hk3 UTSW 13 55014461 missense probably damaging 1.00
R1663:Hk3 UTSW 13 55006575 missense probably benign 0.00
R1936:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1940:Hk3 UTSW 13 55011391 missense probably damaging 0.98
R1966:Hk3 UTSW 13 55014455 missense probably damaging 1.00
R2345:Hk3 UTSW 13 55008993 missense probably damaging 1.00
R4838:Hk3 UTSW 13 55006418 missense probably damaging 1.00
R4852:Hk3 UTSW 13 55012596 missense probably damaging 0.99
R4883:Hk3 UTSW 13 55010922 missense probably benign 0.04
R4888:Hk3 UTSW 13 55006592 missense probably damaging 1.00
R5100:Hk3 UTSW 13 55009030 missense probably damaging 1.00
R5253:Hk3 UTSW 13 55011011 missense probably damaging 1.00
R5328:Hk3 UTSW 13 55013493 missense probably benign 0.00
R5441:Hk3 UTSW 13 55015056 missense probably damaging 1.00
R5493:Hk3 UTSW 13 55011171 missense probably damaging 1.00
R5557:Hk3 UTSW 13 55012075 nonsense probably null
R5575:Hk3 UTSW 13 55014770 missense probably damaging 0.99
R5578:Hk3 UTSW 13 55012181 missense probably damaging 1.00
R5686:Hk3 UTSW 13 55006813 missense probably damaging 1.00
R5872:Hk3 UTSW 13 55010804 missense probably damaging 1.00
R6038:Hk3 UTSW 13 55006560 missense probably benign 0.13
R6038:Hk3 UTSW 13 55006560 missense probably benign 0.13
R6314:Hk3 UTSW 13 55013580 missense probably benign 0.02
R6315:Hk3 UTSW 13 55011157 missense probably benign 0.03
R6797:Hk3 UTSW 13 55010831 splice site probably null
R6827:Hk3 UTSW 13 55011352 missense probably damaging 0.98
R6860:Hk3 UTSW 13 55014465 missense probably damaging 0.98
X0003:Hk3 UTSW 13 55007136 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACCTACGCAGACTCACTGAGGATG -3'
(R):5'- CTTCCGAGGCCAGAAGACTCAATG -3'

Sequencing Primer
(F):5'- CAGACTCACTGAGGATGTAGCTTG -3'
(R):5'- GGAAACCTTGAGAGATGGGTGT -3'
Posted On2014-04-24