Incidental Mutation 'R1568:Ankmy1'
ID175392
Institutional Source Beutler Lab
Gene Symbol Ankmy1
Ensembl Gene ENSMUSG00000034212
Gene Nameankyrin repeat and MYND domain containing 1
Synonyms4930483I10Rik
MMRRC Submission 039607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1568 (G1)
Quality Score103
Status Not validated
Chromosome1
Chromosomal Location92859803-92902906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92881116 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 690 (D690G)
Ref Sequence ENSEMBL: ENSMUSP00000123787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112998] [ENSMUST00000160548]
Predicted Effect probably damaging
Transcript: ENSMUST00000112998
AA Change: D690G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108622
Gene: ENSMUSG00000034212
AA Change: D690G

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 940 980 1.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160548
AA Change: D690G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123787
Gene: ENSMUSG00000034212
AA Change: D690G

DomainStartEndE-ValueType
low complexity region 51 68 N/A INTRINSIC
MORN 87 108 4.22e0 SMART
MORN 110 131 7.05e-5 SMART
MORN 155 176 7.15e1 SMART
ANK 378 407 4.32e-5 SMART
Blast:ANK 575 604 2e-10 BLAST
ANK 607 636 2.63e2 SMART
ANK 643 675 1.87e2 SMART
ANK 719 753 1.73e-4 SMART
ANK 756 785 6.92e-4 SMART
Blast:ANK 790 828 1e-12 BLAST
low complexity region 876 889 N/A INTRINSIC
Pfam:zf-MYND 941 981 2.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Ankmy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Ankmy1 APN 1 92886266 missense probably damaging 1.00
IGL01061:Ankmy1 APN 1 92870974 splice site probably benign
IGL01960:Ankmy1 APN 1 92871663 splice site probably benign
IGL01984:Ankmy1 APN 1 92883765 missense probably damaging 0.99
IGL02193:Ankmy1 APN 1 92881045 missense probably benign 0.03
IGL02536:Ankmy1 APN 1 92886188 missense probably damaging 1.00
IGL02644:Ankmy1 APN 1 92885054 missense probably benign 0.18
IGL02650:Ankmy1 APN 1 92881023 missense probably damaging 1.00
IGL02660:Ankmy1 APN 1 92896094 missense probably damaging 1.00
IGL02808:Ankmy1 APN 1 92886666 missense probably damaging 1.00
PIT4687001:Ankmy1 UTSW 1 92885081 missense probably benign 0.00
R0313:Ankmy1 UTSW 1 92886221 missense probably damaging 1.00
R0373:Ankmy1 UTSW 1 92896190 missense probably damaging 0.99
R0383:Ankmy1 UTSW 1 92885053 missense probably benign 0.00
R0499:Ankmy1 UTSW 1 92886226 missense probably damaging 1.00
R0562:Ankmy1 UTSW 1 92899691 splice site probably benign
R0607:Ankmy1 UTSW 1 92888675 missense probably damaging 1.00
R0739:Ankmy1 UTSW 1 92888648 missense probably damaging 1.00
R0962:Ankmy1 UTSW 1 92899568 nonsense probably null
R1192:Ankmy1 UTSW 1 92883894 missense probably damaging 0.99
R1491:Ankmy1 UTSW 1 92886809 missense probably benign 0.02
R1585:Ankmy1 UTSW 1 92899651 missense probably benign 0.00
R1590:Ankmy1 UTSW 1 92888675 missense probably damaging 1.00
R1664:Ankmy1 UTSW 1 92885191 missense probably benign 0.00
R1714:Ankmy1 UTSW 1 92885194 nonsense probably null
R1818:Ankmy1 UTSW 1 92886831 missense probably benign 0.43
R2014:Ankmy1 UTSW 1 92885141 missense probably benign 0.00
R2043:Ankmy1 UTSW 1 92876527 unclassified probably benign
R2056:Ankmy1 UTSW 1 92881831 missense possibly damaging 0.61
R2427:Ankmy1 UTSW 1 92870807 critical splice donor site probably null
R3806:Ankmy1 UTSW 1 92883758 missense possibly damaging 0.92
R3883:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R3884:Ankmy1 UTSW 1 92886152 missense probably damaging 1.00
R4118:Ankmy1 UTSW 1 92888696 missense possibly damaging 0.60
R4132:Ankmy1 UTSW 1 92885100 missense probably benign
R4441:Ankmy1 UTSW 1 92888661 missense possibly damaging 0.92
R4543:Ankmy1 UTSW 1 92884850 missense probably damaging 1.00
R4602:Ankmy1 UTSW 1 92888650 missense probably benign 0.38
R4779:Ankmy1 UTSW 1 92886723 missense probably benign 0.23
R5200:Ankmy1 UTSW 1 92870292 missense probably benign 0.00
R5381:Ankmy1 UTSW 1 92876562 missense probably benign
R5425:Ankmy1 UTSW 1 92870957 nonsense probably null
R5474:Ankmy1 UTSW 1 92885204 missense possibly damaging 0.59
R5534:Ankmy1 UTSW 1 92886720 missense probably damaging 1.00
R5607:Ankmy1 UTSW 1 92877018 missense probably damaging 1.00
R6112:Ankmy1 UTSW 1 92870962 missense probably damaging 1.00
R6117:Ankmy1 UTSW 1 92861274 unclassified probably benign
R6376:Ankmy1 UTSW 1 92888465 missense possibly damaging 0.60
R6712:Ankmy1 UTSW 1 92870922 missense probably damaging 1.00
R6915:Ankmy1 UTSW 1 92888451 missense probably null 1.00
R7201:Ankmy1 UTSW 1 92886824 missense possibly damaging 0.95
R7432:Ankmy1 UTSW 1 92896079 missense probably benign
R7485:Ankmy1 UTSW 1 92876657 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCAACTTCTCAAGTTGTGACGAG -3'
(R):5'- CACAGTAAAACAGGTTTGGTGGTGC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- tggtggtgcttgcctttg -3'
Posted On2014-04-24