Incidental Mutation 'R1568:Atp8b2'
ID175401
Institutional Source Beutler Lab
Gene Symbol Atp8b2
Ensembl Gene ENSMUSG00000060671
Gene NameATPase, class I, type 8B, member 2
SynonymsId
MMRRC Submission 039607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R1568 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89939481-89963508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89949848 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 402 (M402V)
Ref Sequence ENSEMBL: ENSMUSP00000128423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000168276] [ENSMUST00000170696] [ENSMUST00000170739]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069805
AA Change: M421V

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: M421V

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
low complexity region 80 96 N/A INTRINSIC
Pfam:E1-E2_ATPase 103 374 5.6e-18 PFAM
Pfam:HAD 408 842 1.3e-17 PFAM
Pfam:Hydrolase_like2 491 590 1e-11 PFAM
Pfam:Hydrolase 590 845 7.9e-8 PFAM
low complexity region 1133 1147 N/A INTRINSIC
low complexity region 1167 1190 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107396
AA Change: M402V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: M402V

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 1.3e-29 PFAM
Pfam:E1-E2_ATPase 81 351 2.7e-9 PFAM
Pfam:HAD 389 847 1.5e-17 PFAM
Pfam:Cation_ATPase 472 571 4.3e-12 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2e-84 PFAM
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1172 1195 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167442
Predicted Effect probably damaging
Transcript: ENSMUST00000168276
AA Change: M402V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: M402V

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:E1-E2_ATPase 84 355 2.5e-18 PFAM
Pfam:HAD 389 823 7.9e-18 PFAM
Pfam:Hydrolase_like2 472 571 3.6e-12 PFAM
Pfam:Hydrolase 571 826 6.5e-8 PFAM
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1148 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170324
Predicted Effect probably benign
Transcript: ENSMUST00000170696
SMART Domains Protein: ENSMUSP00000126142
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 1 128 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170739
SMART Domains Protein: ENSMUSP00000127720
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 82 1.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171818
Predicted Effect probably benign
Transcript: ENSMUST00000171941
SMART Domains Protein: ENSMUSP00000130545
Gene: ENSMUSG00000060671

DomainStartEndE-ValueType
Pfam:HAD 2 158 3.3e-8 PFAM
Pfam:Hydrolase_3 124 167 1.7e-6 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Atp8b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Atp8b2 APN 3 89949853 missense probably damaging 1.00
IGL02472:Atp8b2 APN 3 89954239 missense probably damaging 1.00
IGL02651:Atp8b2 APN 3 89954589 unclassified probably null
IGL03057:Atp8b2 APN 3 89944186 missense probably damaging 1.00
IGL03349:Atp8b2 APN 3 89957817 missense probably damaging 1.00
IGL03382:Atp8b2 APN 3 89948521 missense probably benign 0.00
R0550:Atp8b2 UTSW 3 89959061 splice site probably benign
R0784:Atp8b2 UTSW 3 89957073 missense probably damaging 0.99
R1249:Atp8b2 UTSW 3 89947804 missense possibly damaging 0.77
R1447:Atp8b2 UTSW 3 89944170 missense probably damaging 1.00
R1647:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R1736:Atp8b2 UTSW 3 89952694 missense probably damaging 0.98
R1907:Atp8b2 UTSW 3 89946276 missense probably benign 0.28
R2656:Atp8b2 UTSW 3 89941758 missense probably benign 0.05
R2888:Atp8b2 UTSW 3 89958293 missense probably damaging 1.00
R3706:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3708:Atp8b2 UTSW 3 89945152 missense probably damaging 0.99
R3740:Atp8b2 UTSW 3 89946031 missense probably benign
R3741:Atp8b2 UTSW 3 89946031 missense probably benign
R3742:Atp8b2 UTSW 3 89946031 missense probably benign
R3896:Atp8b2 UTSW 3 89957319 missense probably damaging 1.00
R3914:Atp8b2 UTSW 3 89954448 missense probably damaging 0.98
R4536:Atp8b2 UTSW 3 89941784 missense probably benign 0.30
R4770:Atp8b2 UTSW 3 89957067 missense probably damaging 0.97
R4859:Atp8b2 UTSW 3 89945980 missense probably benign
R4905:Atp8b2 UTSW 3 89949008 missense probably benign
R4925:Atp8b2 UTSW 3 89946623 critical splice donor site probably null
R4955:Atp8b2 UTSW 3 89952920 unclassified probably benign
R5433:Atp8b2 UTSW 3 89952909 unclassified probably benign
R5458:Atp8b2 UTSW 3 89946022 missense probably benign 0.00
R5517:Atp8b2 UTSW 3 89946031 missense probably benign
R5663:Atp8b2 UTSW 3 89941794 missense probably benign 0.19
R6056:Atp8b2 UTSW 3 89946221 missense possibly damaging 0.79
R6821:Atp8b2 UTSW 3 89948173 missense probably damaging 0.99
R7069:Atp8b2 UTSW 3 89954571 missense probably damaging 1.00
R7178:Atp8b2 UTSW 3 89943672 missense possibly damaging 0.88
Z1088:Atp8b2 UTSW 3 89954568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGATTCCCCACTCAGGATGCAG -3'
(R):5'- TGTCAGTGGTACACAAGCAGCTC -3'

Sequencing Primer
(F):5'- ATGCAGAGCAGACCCTTG -3'
(R):5'- TCCCCTATGCAGTGTGGAAG -3'
Posted On2014-04-24