Incidental Mutation 'R1568:Clca4a'
ID175406
Institutional Source Beutler Lab
Gene Symbol Clca4a
Ensembl Gene ENSMUSG00000068547
Gene Namechloride channel accessory 4A
SynonymsClca6, 9130020L07Rik
MMRRC Submission 039607-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R1568 (G1)
Quality Score159
Status Not validated
Chromosome3
Chromosomal Location144952480-144975045 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144952929 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 842 (Y842H)
Ref Sequence ENSEMBL: ENSMUSP00000029923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029923]
Predicted Effect probably benign
Transcript: ENSMUST00000029923
AA Change: Y842H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029923
Gene: ENSMUSG00000068547
AA Change: Y842H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 286 300 N/A INTRINSIC
VWA 306 480 5.94e-16 SMART
Blast:VWA 513 552 7e-18 BLAST
Blast:FN3 757 838 8e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136170
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Osr1 G A 12: 9,579,798 probably null Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Clca4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Clca4a APN 3 144954939 missense probably damaging 0.99
IGL01139:Clca4a APN 3 144966269 missense probably damaging 0.99
IGL01371:Clca4a APN 3 144960672 missense probably damaging 1.00
IGL01609:Clca4a APN 3 144953780 missense probably damaging 1.00
IGL01998:Clca4a APN 3 144958126 missense probably damaging 0.98
IGL02172:Clca4a APN 3 144970394 nonsense probably null
IGL02217:Clca4a APN 3 144961996 missense possibly damaging 0.61
IGL02514:Clca4a APN 3 144955071 missense probably damaging 1.00
IGL02975:Clca4a APN 3 144963769 missense possibly damaging 0.90
IGL03025:Clca4a APN 3 144957318 missense probably benign 0.07
IGL03049:Clca4a APN 3 144970755 splice site probably benign
IGL03058:Clca4a APN 3 144961834 splice site probably benign
IGL03259:Clca4a APN 3 144958080 missense probably damaging 1.00
IGL03263:Clca4a APN 3 144966431 missense probably damaging 1.00
IGL03334:Clca4a APN 3 144953866 missense probably benign 0.28
PIT4142001:Clca4a UTSW 3 144968311 missense probably damaging 1.00
R0201:Clca4a UTSW 3 144960717 missense probably benign 0.00
R0316:Clca4a UTSW 3 144953764 missense probably damaging 1.00
R0524:Clca4a UTSW 3 144969393 missense probably damaging 1.00
R0680:Clca4a UTSW 3 144969367 missense probably damaging 1.00
R0688:Clca4a UTSW 3 144961974 missense probably damaging 1.00
R1137:Clca4a UTSW 3 144970685 missense probably damaging 1.00
R1719:Clca4a UTSW 3 144963755 missense probably damaging 1.00
R2055:Clca4a UTSW 3 144970728 missense probably damaging 1.00
R3078:Clca4a UTSW 3 144968253 missense probably damaging 0.99
R3080:Clca4a UTSW 3 144963790 missense probably damaging 1.00
R3789:Clca4a UTSW 3 144974956 missense probably damaging 1.00
R3881:Clca4a UTSW 3 144957318 missense probably benign 0.07
R4133:Clca4a UTSW 3 144969352 missense probably benign 0.07
R4402:Clca4a UTSW 3 144952848 missense probably benign 0.08
R4455:Clca4a UTSW 3 144957259 missense probably damaging 1.00
R4577:Clca4a UTSW 3 144954969 missense probably damaging 0.97
R4683:Clca4a UTSW 3 144954940 missense probably damaging 1.00
R5135:Clca4a UTSW 3 144954946 missense probably damaging 1.00
R5267:Clca4a UTSW 3 144953812 missense probably damaging 1.00
R5345:Clca4a UTSW 3 144970461 missense probably damaging 1.00
R6311:Clca4a UTSW 3 144966413 missense probably damaging 0.99
R6492:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6493:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6494:Clca4a UTSW 3 144957298 missense probably benign 0.00
R6861:Clca4a UTSW 3 144970655 missense probably benign
R7102:Clca4a UTSW 3 144961909 missense probably benign 0.01
R7133:Clca4a UTSW 3 144961890 nonsense probably null
R7171:Clca4a UTSW 3 144958173 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTGGTAGCTTTTCACAGAATGGGTGT -3'
(R):5'- ATGGTGTGATGCAGTAACTAACCCAC -3'

Sequencing Primer
(F):5'- TTATAGCTGCTGATGAGGACC -3'
(R):5'- ACCCACACATAACATTTTTGTCAG -3'
Posted On2014-04-24