Incidental Mutation 'R1568:Osr1'
ID175435
Institutional Source Beutler Lab
Gene Symbol Osr1
Ensembl Gene ENSMUSG00000048387
Gene Nameodd-skipped related transcription factor 1
SynonymsOdd1
MMRRC Submission 039607-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R1568 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location9570116-9581500 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 9579798 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057021] [ENSMUST00000217975]
Predicted Effect probably null
Transcript: ENSMUST00000057021
SMART Domains Protein: ENSMUSP00000055486
Gene: ENSMUSG00000048387

DomainStartEndE-ValueType
low complexity region 134 151 N/A INTRINSIC
ZnF_C2H2 175 197 1.67e-2 SMART
ZnF_C2H2 203 225 2.4e-3 SMART
ZnF_C2H2 231 253 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217975
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation fail to form atrial septum and exhibit dilated atria with hypoplastic venous valves and blood backflow from the heart into systemic veins. Complete agenesis of adrenal glands, metanephric kidneys, gonads, and defects in pericardium formation are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik T C 11: 23,589,971 K48E probably damaging Het
4931408C20Rik T C 1: 26,685,869 T77A probably benign Het
Adam18 T G 8: 24,647,783 probably null Het
Adgb A T 10: 10,442,665 Y138* probably null Het
Adra1d T C 2: 131,546,172 R488G possibly damaging Het
Ahnak G A 19: 9,002,375 G341E probably damaging Het
Ankmy1 T C 1: 92,881,116 D690G probably damaging Het
Arhgef38 C T 3: 133,132,464 E21K probably damaging Het
Atp8b2 T C 3: 89,949,848 M402V probably damaging Het
Atp8b4 G T 2: 126,325,394 H1062N probably benign Het
Bdnf A G 2: 109,723,794 H131R probably damaging Het
Cblb C T 16: 52,135,829 T265M probably damaging Het
Cenpe T A 3: 135,239,758 M1011K probably benign Het
Clca2 A T 3: 145,075,649 Y711* probably null Het
Clca4a A G 3: 144,952,929 Y842H probably benign Het
Clspn T A 4: 126,581,517 M1021K probably benign Het
Cpne8 G T 15: 90,619,642 R107S probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Dsp T C 13: 38,175,147 I298T probably damaging Het
Dync2h1 T C 9: 7,157,553 K858R probably null Het
Fasn A T 11: 120,813,249 V1448E possibly damaging Het
Ghdc A G 11: 100,768,505 I322T probably benign Het
Gins2 T C 8: 120,582,200 D105G probably damaging Het
Insr A T 8: 3,165,576 D975E probably benign Het
Klrc3 T C 6: 129,639,547 D169G probably benign Het
Krt76 T A 15: 101,885,008 S532C unknown Het
Lamp3 A T 16: 19,673,525 M323K probably damaging Het
Lgmn T C 12: 102,394,609 I423M possibly damaging Het
Lpgat1 A T 1: 191,776,426 T359S possibly damaging Het
Lrguk T A 6: 34,086,438 I466N probably damaging Het
Magi3 A C 3: 104,089,527 M234R probably benign Het
Myh14 G A 7: 44,611,698 R1042* probably null Het
Nfia T G 4: 98,111,224 Y378D possibly damaging Het
Npffr1 T A 10: 61,626,233 S383T possibly damaging Het
Olfr1308 C A 2: 111,960,240 V278F probably benign Het
Olfr1410 T C 1: 92,607,954 L39P probably damaging Het
Olfr1466 C A 19: 13,342,175 P139Q probably benign Het
Olfr658 T A 7: 104,644,770 I199F probably benign Het
Pde4b A C 4: 102,597,699 R375S probably damaging Het
Pde8a A G 7: 81,292,263 E150G probably damaging Het
Pkhd1l1 A T 15: 44,545,501 probably null Het
Ppp3ca A G 3: 136,928,544 T422A probably benign Het
Proser1 T C 3: 53,477,759 V354A possibly damaging Het
Rgs20 G T 1: 5,020,827 R127S probably benign Het
Sec22a T C 16: 35,347,628 D171G probably benign Het
Secisbp2 A G 13: 51,673,107 E417G possibly damaging Het
Serpinb6b T C 13: 32,974,912 L32S probably damaging Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Slc39a10 A T 1: 46,826,215 S487T probably benign Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Spag6 A G 2: 18,733,114 D265G probably benign Het
Sybu G T 15: 44,718,832 S132* probably null Het
Virma T C 4: 11,528,776 S1288P probably damaging Het
Vmn1r229 T A 17: 20,814,805 V104D probably damaging Het
Vmn1r238 T C 18: 3,123,358 T19A probably benign Het
Vmn2r86 C T 10: 130,453,141 V164I probably benign Het
Wfdc13 G T 2: 164,686,934 A64S probably damaging Het
Zfp873 C A 10: 82,060,279 H318Q probably damaging Het
Zyg11a A G 4: 108,183,646 probably null Het
Other mutations in Osr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Osr1 APN 12 9579432 missense probably benign 0.00
IGL01508:Osr1 APN 12 9579370 missense probably damaging 1.00
IGL02583:Osr1 APN 12 9579675 missense probably damaging 1.00
R0077:Osr1 UTSW 12 9579691 missense probably damaging 1.00
R0218:Osr1 UTSW 12 9579639 missense probably benign 0.09
R1223:Osr1 UTSW 12 9579699 missense probably damaging 1.00
R1924:Osr1 UTSW 12 9579268 missense probably damaging 1.00
R1939:Osr1 UTSW 12 9579687 missense probably damaging 1.00
R5580:Osr1 UTSW 12 9579325 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGCCTCGCTTTGATTTCGCTAAC -3'
(R):5'- GGCAGGGCAAGGGAGTTCATTTATG -3'

Sequencing Primer
(F):5'- TGGACGTGACCAAGCTATC -3'
(R):5'- TATGGATTTAGAGACTCCCCCAGAG -3'
Posted On2014-04-24