Incidental Mutation 'R1591:Acvr1b'
ID175527
Institutional Source Beutler Lab
Gene Symbol Acvr1b
Ensembl Gene ENSMUSG00000000532
Gene Nameactivin A receptor, type 1B
SynonymsActR-IB, ActRIB, Alk4, SKR2, Acvrlk4
MMRRC Submission 039628-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1591 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101174067-101213684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 101194024 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 62 (V62L)
Ref Sequence ENSEMBL: ENSMUSP00000000544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000544]
Predicted Effect probably benign
Transcript: ENSMUST00000000544
AA Change: V62L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000544
Gene: ENSMUSG00000000532
AA Change: V62L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 32 108 4.1e-13 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 177 207 1.89e-14 SMART
Blast:STYKc 209 494 2e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199512
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 89.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an activin A type IB receptor. Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I and two type II receptors. This protein is a type I receptor which is essential for signaling. Mutations in this gene are associated with pituitary tumors. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
PHENOTYPE: Embryos homozygous for targeted mutations that inactivate the gene arrest at the egg cylinder stage, prior to gastrulation, showing epiblast and extraembryonic ectoderm disorganization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 G T 5: 100,809,639 Q201K probably benign Het
Acacb A T 5: 114,203,423 I829F possibly damaging Het
Adam6b A T 12: 113,489,832 I90F probably benign Het
Adgrf1 T C 17: 43,310,981 L703P probably damaging Het
Arf3 T C 15: 98,742,788 probably benign Het
Asns T C 6: 7,678,007 D357G probably damaging Het
Atr T C 9: 95,945,385 M2461T probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
Bod1l T C 5: 41,819,220 I1584V probably benign Het
Bub3 T C 7: 131,561,608 probably null Het
Camkk2 A G 5: 122,757,558 probably null Het
Cand1 G T 10: 119,211,869 T572K possibly damaging Het
Caprin2 A T 6: 148,873,108 S235R possibly damaging Het
Cdh24 T C 14: 54,636,342 T452A probably benign Het
Cdh4 T C 2: 179,886,864 probably null Het
Cfap61 A G 2: 146,145,458 R1060G probably benign Het
Chd9 A G 8: 90,983,538 D314G probably damaging Het
Csmd1 T A 8: 15,900,710 I3500F probably damaging Het
Dnah1 G T 14: 31,272,332 Q2858K probably benign Het
Dnah6 C T 6: 73,076,600 E2884K probably benign Het
Ecm1 G A 3: 95,735,963 R342C probably damaging Het
Exosc10 T A 4: 148,568,383 I485N probably benign Het
Fap T C 2: 62,553,857 K2E probably damaging Het
Fgfr1 G A 8: 25,572,720 G671D probably damaging Het
Fzr1 C T 10: 81,370,367 R162Q possibly damaging Het
Gm17727 T C 9: 35,776,656 D96G probably damaging Het
Grap2 A T 15: 80,648,448 Y272F probably damaging Het
Il11ra1 T A 4: 41,766,200 W246R probably damaging Het
Kcna3 A T 3: 107,037,029 I203F probably damaging Het
Kcng1 T C 2: 168,268,710 E178G possibly damaging Het
Kif19a A C 11: 114,789,231 H798P probably benign Het
Kif21b T C 1: 136,149,317 L359P probably damaging Het
Krt6a A T 15: 101,692,357 probably null Het
Lman1l C T 9: 57,615,802 V125I probably benign Het
Lrp1 C T 10: 127,605,606 S216N probably benign Het
Lrp3 A G 7: 35,202,365 V676A probably benign Het
Lrrc63 T A 14: 75,125,892 K266N possibly damaging Het
Mccc1 C T 3: 35,989,857 V246M probably damaging Het
Mdn1 T C 4: 32,700,092 V1395A possibly damaging Het
Mmrn1 A T 6: 60,944,771 R71* probably null Het
Mrps2 C T 2: 28,469,488 A119V probably benign Het
Ogdh T C 11: 6,349,384 F750S probably damaging Het
Olfr147 A G 9: 38,402,936 T18A probably damaging Het
Olfr356 C A 2: 36,937,978 N286K probably damaging Het
Olfr484 T A 7: 108,124,364 I300F possibly damaging Het
Olfr612 T G 7: 103,539,067 T56P probably benign Het
Olfr901 A T 9: 38,430,411 N43I probably damaging Het
Osbpl11 A C 16: 33,209,983 I194L probably benign Het
Pacsin2 T C 15: 83,385,051 E14G probably damaging Het
Pcdh7 A G 5: 57,720,422 T440A probably damaging Het
Pcdhb17 T C 18: 37,485,825 S223P probably damaging Het
Pik3c2g G A 6: 139,748,178 R109K probably benign Het
Ppp2ca T C 11: 52,099,089 I14T possibly damaging Het
Rdh12 A T 12: 79,211,504 T102S probably damaging Het
Rsf1 T A 7: 97,639,313 C132* probably null Het
Rufy1 G A 11: 50,394,928 L621F probably damaging Het
Ruvbl2 C T 7: 45,424,711 R253H possibly damaging Het
Sdf2 A G 11: 78,254,993 E172G probably damaging Het
Skint5 C T 4: 113,999,454 probably null Het
Slc25a27 A G 17: 43,653,424 I185T probably benign Het
Slc41a3 A C 6: 90,633,695 K180Q probably benign Het
Slc7a14 A C 3: 31,237,449 F227V probably damaging Het
Smg1 T C 7: 118,156,919 probably benign Het
St6galnac1 A T 11: 116,765,863 D483E probably damaging Het
Tes A G 6: 17,097,442 K183R probably damaging Het
Tgfbr1 G T 4: 47,403,471 D290Y probably damaging Het
Tifab T A 13: 56,176,351 Y93F probably benign Het
Tmem131l A G 3: 83,940,889 probably null Het
Tnfrsf21 T A 17: 43,085,374 S516R probably benign Het
Ttn T C 2: 76,776,045 Y18140C probably damaging Het
Unc13b T A 4: 43,244,747 S3692T probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfp113 T C 5: 138,151,197 probably benign Het
Zfp26 T C 9: 20,437,625 T548A probably benign Het
Zfp870 C T 17: 32,884,016 G114D probably damaging Het
Other mutations in Acvr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02983:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03010:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03011:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03013:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03051:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03127:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03166:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL03265:Acvr1b APN 15 101203078 missense probably damaging 0.98
IGL02980:Acvr1b UTSW 15 101203078 missense probably damaging 0.98
IGL02984:Acvr1b UTSW 15 101203078 missense probably damaging 0.98
R1367:Acvr1b UTSW 15 101193938 missense possibly damaging 0.58
R1498:Acvr1b UTSW 15 101194010 missense probably benign
R1757:Acvr1b UTSW 15 101198822 missense possibly damaging 0.47
R1793:Acvr1b UTSW 15 101194025 missense probably benign 0.01
R2223:Acvr1b UTSW 15 101203043 missense probably benign 0.10
R2249:Acvr1b UTSW 15 101203094 missense probably null 1.00
R4674:Acvr1b UTSW 15 101203058 missense possibly damaging 0.94
R4676:Acvr1b UTSW 15 101202986 missense probably damaging 1.00
R5151:Acvr1b UTSW 15 101210770 missense probably damaging 1.00
R5223:Acvr1b UTSW 15 101193976 missense probably damaging 1.00
R5397:Acvr1b UTSW 15 101198964 missense probably damaging 0.99
R5574:Acvr1b UTSW 15 101202077 missense probably benign 0.03
R5906:Acvr1b UTSW 15 101193891 intron probably benign
R6025:Acvr1b UTSW 15 101194975 missense probably benign 0.43
R6467:Acvr1b UTSW 15 101194841 missense possibly damaging 0.86
X0067:Acvr1b UTSW 15 101194022 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TAAGGTGCAGTAGTGCCAGCCAAG -3'
(R):5'- CGAAAGGACAAGATGCCCTTCCTC -3'

Sequencing Primer
(F):5'- CCGGCTCTATAAAAGCTGCTTATTG -3'
(R):5'- TCCACGGTGAGGCAACAG -3'
Posted On2014-04-24