Incidental Mutation 'R1593:Tpp2'
ID175594
Institutional Source Beutler Lab
Gene Symbol Tpp2
Ensembl Gene ENSMUSG00000041763
Gene Nametripeptidyl peptidase II
SynonymsTppII
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.490) question?
Stock #R1593 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location43933647-44003000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43975433 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 644 (H644R)
Ref Sequence ENSEMBL: ENSMUSP00000139918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388]
Predicted Effect probably benign
Transcript: ENSMUST00000087933
AA Change: H644R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: H644R

DomainStartEndE-ValueType
Pfam:Peptidase_S8 35 500 1.4e-96 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 777 964 2.4e-80 PFAM
low complexity region 1017 1033 N/A INTRINSIC
PDB:3LXU|X 1034 1262 1e-20 PDB
Predicted Effect unknown
Transcript: ENSMUST00000186441
AA Change: H152R
Predicted Effect probably benign
Transcript: ENSMUST00000188302
SMART Domains Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 4.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188313
AA Change: H644R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: H644R

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 5.1e-83 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 966 2.7e-93 PFAM
low complexity region 1004 1020 N/A INTRINSIC
PDB:3LXU|X 1021 1249 1e-20 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000189388
AA Change: H644R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763
AA Change: H644R

DomainStartEndE-ValueType
Pfam:Peptidase_S8 39 509 2.3e-81 PFAM
low complexity region 674 685 N/A INTRINSIC
Pfam:TPPII 773 880 7.8e-49 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zbtb20 A G 16: 43,609,423 N99S probably damaging Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Tpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Tpp2 APN 1 43983291 missense possibly damaging 0.90
IGL01021:Tpp2 APN 1 43934187 nonsense probably null
IGL01096:Tpp2 APN 1 43960888 missense probably damaging 1.00
IGL01344:Tpp2 APN 1 43983262 missense probably benign 0.04
IGL01642:Tpp2 APN 1 43954653 missense probably damaging 1.00
IGL02719:Tpp2 APN 1 43940231 missense probably benign 0.09
IGL02890:Tpp2 APN 1 43999690 missense probably damaging 1.00
IGL03102:Tpp2 APN 1 43956489 missense probably damaging 1.00
IGL03175:Tpp2 APN 1 43973511 missense probably benign 0.35
beaver UTSW 1 43971715 missense probably benign 0.08
cleaver UTSW 1 43978508 nonsense probably null
eddie UTSW 1 43968988 missense probably damaging 1.00
June UTSW 1 43954710 missense probably damaging 1.00
state UTSW 1 43978438 missense possibly damaging 0.48
wally UTSW 1 43992396 critical splice donor site probably null
Ward UTSW 1 43954736 missense possibly damaging 0.82
R0001:Tpp2 UTSW 1 43971726 missense probably benign 0.00
R0003:Tpp2 UTSW 1 43960139 missense possibly damaging 0.94
R0066:Tpp2 UTSW 1 43981748 missense possibly damaging 0.56
R0110:Tpp2 UTSW 1 43999693 missense probably damaging 1.00
R0110:Tpp2 UTSW 1 43978504 missense probably benign 0.00
R0167:Tpp2 UTSW 1 43970488 missense probably benign 0.01
R0441:Tpp2 UTSW 1 43990562 missense possibly damaging 0.85
R0520:Tpp2 UTSW 1 43990530 missense probably damaging 1.00
R0639:Tpp2 UTSW 1 43975447 missense probably benign 0.00
R1118:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1119:Tpp2 UTSW 1 43992396 critical splice donor site probably null
R1702:Tpp2 UTSW 1 43990548 missense probably damaging 0.99
R1756:Tpp2 UTSW 1 43978725 splice site probably null
R2066:Tpp2 UTSW 1 43978438 missense possibly damaging 0.48
R2171:Tpp2 UTSW 1 43957446 missense probably benign 0.00
R2378:Tpp2 UTSW 1 43999765 missense probably damaging 0.99
R2394:Tpp2 UTSW 1 43983186 missense possibly damaging 0.83
R2507:Tpp2 UTSW 1 44001449 missense probably benign 0.31
R2879:Tpp2 UTSW 1 43971623 missense probably damaging 1.00
R3436:Tpp2 UTSW 1 43940144 missense probably damaging 0.99
R4106:Tpp2 UTSW 1 44001457 missense possibly damaging 0.71
R4658:Tpp2 UTSW 1 43954710 missense probably damaging 1.00
R4760:Tpp2 UTSW 1 43971715 missense probably benign 0.08
R4963:Tpp2 UTSW 1 43992268 missense probably damaging 1.00
R5049:Tpp2 UTSW 1 44001473 missense possibly damaging 0.46
R5073:Tpp2 UTSW 1 43954736 missense possibly damaging 0.82
R6010:Tpp2 UTSW 1 43951213 critical splice donor site probably null
R6118:Tpp2 UTSW 1 43940146 missense probably damaging 1.00
R6155:Tpp2 UTSW 1 43956489 missense probably damaging 1.00
R6169:Tpp2 UTSW 1 43983579 missense probably damaging 0.99
R6236:Tpp2 UTSW 1 43977317 missense probably benign 0.01
R6695:Tpp2 UTSW 1 43983276 missense probably benign
R6845:Tpp2 UTSW 1 43978508 nonsense probably null
R7054:Tpp2 UTSW 1 43983158 missense probably damaging 1.00
R7094:Tpp2 UTSW 1 43968988 missense probably damaging 1.00
R7223:Tpp2 UTSW 1 43968888 missense probably damaging 1.00
R7316:Tpp2 UTSW 1 43970431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCATCTGTGTGCTGCTGTCAGAG -3'
(R):5'- TCTATACCGGAGCCCAGACTCATTC -3'

Sequencing Primer
(F):5'- CTGCTGTCAGAGGTTATATCTACTGC -3'
(R):5'- CAGACTCATTCCCTAAAGTGGTG -3'
Posted On2014-04-24