Incidental Mutation 'R1593:Zbtb20'
ID175641
Institutional Source Beutler Lab
Gene Symbol Zbtb20
Ensembl Gene ENSMUSG00000022708
Gene Namezinc finger and BTB domain containing 20
SynonymsZfp288, D16Wsu73e, 7330412A13Rik, 1300017A20Rik, HOF, A930017C21Rik
MMRRC Submission 039630-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1593 (G1)
Quality Score122
Status Not validated
Chromosome16
Chromosomal Location42875881-43642602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43609423 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 99 (N99S)
Ref Sequence ENSEMBL: ENSMUSP00000124126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079441
AA Change: N99S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: N99S

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114690
AA Change: N26S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: N26S

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114691
AA Change: N26S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: N26S

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114694
AA Change: N99S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: N99S

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114695
AA Change: N99S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: N99S

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146708
AA Change: N26S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708
AA Change: N26S

DomainStartEndE-ValueType
Pfam:BTB 21 74 3.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148775
AA Change: N26S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708
AA Change: N26S

DomainStartEndE-ValueType
Pfam:BTB 21 60 9.8e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156367
AA Change: N99S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708
AA Change: N99S

DomainStartEndE-ValueType
Pfam:BTB 94 131 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156981
AA Change: N26S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708
AA Change: N26S

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly A T 11: 100,481,755 I902N possibly damaging Het
Acsl6 A G 11: 54,323,308 D88G probably damaging Het
Adam1a A C 5: 121,519,643 I529S probably benign Het
Ap3b1 T C 13: 94,501,927 V838A unknown Het
Arrdc2 T C 8: 70,837,120 Y280C probably damaging Het
Atg10 T C 13: 91,154,261 T53A probably benign Het
Ccdc136 T C 6: 29,415,584 S699P probably damaging Het
Cdc23 C A 18: 34,636,326 V462L possibly damaging Het
Clcn6 C T 4: 148,014,594 A431T probably benign Het
Cntn6 T G 6: 104,832,580 H525Q possibly damaging Het
Ctr9 T C 7: 111,042,853 F296S possibly damaging Het
Ctsq T A 13: 61,036,172 probably null Het
Ehd1 A G 19: 6,298,300 D436G probably benign Het
Epha6 A T 16: 60,424,904 F311I probably damaging Het
Esrrg A T 1: 188,066,385 T150S possibly damaging Het
Exoc2 C A 13: 30,856,761 R758L possibly damaging Het
Exosc7 G C 9: 123,131,993 V242L probably benign Het
Fcho2 T C 13: 98,784,807 D190G possibly damaging Het
Fgd6 T C 10: 94,045,032 S583P probably damaging Het
Frmd4a A G 2: 4,473,188 Y60C probably damaging Het
Gldc A T 19: 30,113,750 I815N probably damaging Het
Grm2 A T 9: 106,650,914 L257Q probably damaging Het
Hectd3 C A 4: 116,997,020 T289K possibly damaging Het
Itgb4 T C 11: 115,980,991 V207A probably damaging Het
Lamb3 A G 1: 193,330,796 E443G probably damaging Het
Meis2 T A 2: 116,000,264 D256V probably damaging Het
Muc4 A G 16: 32,754,686 N1520S probably benign Het
Nckap1l A G 15: 103,478,854 R719G probably null Het
Olfr800 A T 10: 129,660,225 R140* probably null Het
Pabpc6 A T 17: 9,667,813 M603K probably damaging Het
Pcnx2 C A 8: 125,759,273 R1862L probably benign Het
Pon2 T C 6: 5,273,003 D122G probably benign Het
Ppig T A 2: 69,749,081 W378R unknown Het
Ralgapa1 T A 12: 55,770,703 E389D probably damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rarg A G 15: 102,239,941 F233L probably damaging Het
Rasgrp2 T C 19: 6,403,460 F90L possibly damaging Het
Rrp12 T A 19: 41,863,241 H1285L probably benign Het
Slc16a13 C A 11: 70,219,082 A198S probably benign Het
Spag9 A G 11: 94,097,233 D441G probably damaging Het
Stxbp5l A G 16: 37,116,052 F1099S probably damaging Het
Tex19.1 T A 11: 121,147,253 W146R probably damaging Het
Tmem8 T A 17: 26,118,407 I399N possibly damaging Het
Tmod3 T C 9: 75,511,163 D197G probably benign Het
Tpp2 A G 1: 43,975,433 H644R probably benign Het
Trpm2 A G 10: 77,943,076 V352A possibly damaging Het
Tulp1 T C 17: 28,362,701 K233E probably damaging Het
Vsir A G 10: 60,357,958 T67A possibly damaging Het
Wdr49 T C 3: 75,396,941 N487S probably benign Het
Zfp583 C T 7: 6,317,009 G335S probably benign Het
Zgrf1 T A 3: 127,561,026 V98E possibly damaging Het
Other mutations in Zbtb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Zbtb20 APN 16 43610661 missense possibly damaging 0.85
IGL02170:Zbtb20 APN 16 43609662 missense possibly damaging 0.84
IGL02292:Zbtb20 APN 16 43610648 nonsense probably null
IGL02733:Zbtb20 APN 16 43609933 missense possibly damaging 0.48
IGL03277:Zbtb20 APN 16 43618437 missense possibly damaging 0.95
siberian UTSW 16 43610676 missense probably damaging 0.96
Tiger UTSW 16 43618398 missense probably damaging 0.98
Towering UTSW 16 43610867 nonsense probably null
R0310:Zbtb20 UTSW 16 43609746 missense probably damaging 0.98
R1996:Zbtb20 UTSW 16 43610080 missense probably damaging 0.98
R2018:Zbtb20 UTSW 16 43577652 missense possibly damaging 0.86
R2050:Zbtb20 UTSW 16 43609612 unclassified probably null
R2097:Zbtb20 UTSW 16 43609519 missense probably null 1.00
R4006:Zbtb20 UTSW 16 43609399 missense probably damaging 1.00
R4708:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R4710:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R4835:Zbtb20 UTSW 16 43618398 missense probably damaging 0.98
R4962:Zbtb20 UTSW 16 43618692 missense probably damaging 0.99
R5531:Zbtb20 UTSW 16 43610867 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGTGTGCAGTATCCCCAGCTTTC -3'
(R):5'- AACACATCGCCCACGTTCTGTGAC -3'

Sequencing Primer
(F):5'- AGCGTTACTCTTCTAAGACCTGAG -3'
(R):5'- CCGCTGTACATGAAGTCAATG -3'
Posted On2014-04-24