Incidental Mutation 'R1592:Kcnj3'
ID175655
Institutional Source Beutler Lab
Gene Symbol Kcnj3
Ensembl Gene ENSMUSG00000026824
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 3
SynonymsGIRK1, Kcnf3, Kir3.1
MMRRC Submission 039629-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1592 (G1)
Quality Score160
Status Validated
Chromosome2
Chromosomal Location55435970-55598145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55437886 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 229 (R229L)
Ref Sequence ENSEMBL: ENSMUSP00000108252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067101] [ENSMUST00000112632] [ENSMUST00000112633]
Predicted Effect probably damaging
Transcript: ENSMUST00000067101
AA Change: R229L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063329
Gene: ENSMUSG00000026824
AA Change: R229L

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 385 3.6e-164 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112632
AA Change: R229L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108251
Gene: ENSMUSG00000026824
AA Change: R229L

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 235 4e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112633
AA Change: R229L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108252
Gene: ENSMUSG00000026824
AA Change: R229L

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
Pfam:IRK 47 369 1.1e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180810
Meta Mutation Damage Score 0.7 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation display slightly increased resting heart rates, and blunted responses to both indirect vagal activation and direct adenosine A1 receptor activation (intended to activate the muscarinic-gated atrial potassium channel). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,645,381 E327G probably damaging Het
Acp5 A T 9: 22,127,851 W189R probably damaging Het
Adamts8 T C 9: 30,943,176 S114P probably damaging Het
Alkbh3 A C 2: 94,008,424 probably null Het
Ankrd13d T C 19: 4,282,891 H27R probably benign Het
Aox2 A G 1: 58,300,694 N382S probably benign Het
Aspg G A 12: 112,119,972 R220Q probably benign Het
Atg16l2 C A 7: 101,291,986 G403V probably damaging Het
Bcat1 G T 6: 145,010,058 Q299K probably benign Het
Cc2d1b C T 4: 108,626,671 probably benign Het
Cdh26 T C 2: 178,449,891 F81S probably damaging Het
Cnbd2 A G 2: 156,335,402 I222M probably benign Het
Ephb3 T C 16: 21,221,700 V562A probably damaging Het
Fam186a T C 15: 99,940,318 T2682A probably benign Het
Fat2 T C 11: 55,291,870 probably null Het
Fat4 A T 3: 39,007,177 D4303V probably damaging Het
Fbln1 T A 15: 85,231,464 S234T probably benign Het
Gldc G A 19: 30,160,677 probably benign Het
Gli1 A C 10: 127,331,329 V685G probably damaging Het
H2-T22 T C 17: 36,041,577 N152S probably damaging Het
Inpp5d A T 1: 87,665,532 D118V possibly damaging Het
Ints10 A G 8: 68,802,903 I182V possibly damaging Het
Ipcef1 C T 10: 6,935,182 probably null Het
Klf11 C A 12: 24,653,738 D57E probably damaging Het
Krt73 G T 15: 101,802,239 S20* probably null Het
Lactbl1 A G 4: 136,635,876 probably null Het
Mapk10 T C 5: 103,038,621 D45G possibly damaging Het
Mfrp G A 9: 44,103,222 C222Y probably damaging Het
Mga A T 2: 119,964,666 I2944F possibly damaging Het
Msh2 A G 17: 87,680,013 probably null Het
Nckap1l T A 15: 103,482,180 probably null Het
Olfr1034 A G 2: 86,046,989 N169S probably benign Het
Pitpnm1 T A 19: 4,106,964 probably null Het
Sik2 C T 9: 50,995,671 V85I probably damaging Het
Slc26a7 T A 4: 14,552,470 E229V probably benign Het
Spty2d1 A T 7: 46,998,889 D97E possibly damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Uggt1 C A 1: 36,202,858 A332S probably benign Het
Usp53 A T 3: 122,934,050 L961* probably null Het
Vmn1r223 A T 13: 23,249,667 T144S possibly damaging Het
Wdfy1 G A 1: 79,706,255 R388C probably damaging Het
Zfp995 T A 17: 21,887,340 M1L probably damaging Het
Other mutations in Kcnj3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Kcnj3 APN 2 55595272 missense possibly damaging 0.88
IGL01889:Kcnj3 APN 2 55437204 missense possibly damaging 0.69
IGL01988:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL01989:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02004:Kcnj3 APN 2 55437231 missense probably benign 0.43
IGL02035:Kcnj3 APN 2 55437578 missense probably damaging 1.00
R0268:Kcnj3 UTSW 2 55594959 nonsense probably null
R0565:Kcnj3 UTSW 2 55595264 missense probably benign 0.03
R0853:Kcnj3 UTSW 2 55437223 missense possibly damaging 0.69
R1318:Kcnj3 UTSW 2 55437738 missense possibly damaging 0.88
R1756:Kcnj3 UTSW 2 55437220 missense probably damaging 1.00
R1899:Kcnj3 UTSW 2 55437244 missense probably damaging 1.00
R1966:Kcnj3 UTSW 2 55437331 missense probably damaging 0.99
R2891:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R2892:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R2893:Kcnj3 UTSW 2 55447015 missense probably damaging 1.00
R3901:Kcnj3 UTSW 2 55437348 missense possibly damaging 0.46
R4470:Kcnj3 UTSW 2 55437865 missense probably damaging 1.00
R4603:Kcnj3 UTSW 2 55446979 nonsense probably null
R4694:Kcnj3 UTSW 2 55594906 missense probably benign 0.00
R4945:Kcnj3 UTSW 2 55437578 missense probably damaging 1.00
R5144:Kcnj3 UTSW 2 55447047 splice site probably null
R5332:Kcnj3 UTSW 2 55437547 missense probably damaging 1.00
R5959:Kcnj3 UTSW 2 55437318 missense probably benign 0.10
R6352:Kcnj3 UTSW 2 55437549 missense probably benign 0.06
R7042:Kcnj3 UTSW 2 55594865 missense possibly damaging 0.87
R7475:Kcnj3 UTSW 2 55437326 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATCGTGGACGCTTTCCTCATCG -3'
(R):5'- GCAACTATGCCCTCTGCCCAATTAC -3'

Sequencing Primer
(F):5'- ATCGGCTGCATGTTCATCAAG -3'
(R):5'- GCCCAATTACCATCCCTTTTTAC -3'
Posted On2014-04-24