Incidental Mutation 'R1592:Spty2d1'
ID175672
Institutional Source Beutler Lab
Gene Symbol Spty2d1
Ensembl Gene ENSMUSG00000049516
Gene NameSPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)
Synonyms5830435K17Rik
MMRRC Submission 039629-MU
Accession Numbers

Genbank: NM_175318; MGI: 2142062

Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R1592 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46990396-47008411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46998889 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 97 (D97E)
Ref Sequence ENSEMBL: ENSMUSP00000059457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061639]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061639
AA Change: D97E

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059457
Gene: ENSMUSG00000049516
AA Change: D97E

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
coiled coil region 45 82 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 199 215 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
internal_repeat_1 283 336 4.09e-5 PROSPERO
low complexity region 338 353 N/A INTRINSIC
internal_repeat_1 366 420 4.09e-5 PROSPERO
low complexity region 434 468 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
SPT2 573 680 1.3e-32 SMART
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (51/51)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,645,381 E327G probably damaging Het
Acp5 A T 9: 22,127,851 W189R probably damaging Het
Adamts8 T C 9: 30,943,176 S114P probably damaging Het
Alkbh3 A C 2: 94,008,424 probably null Het
Ankrd13d T C 19: 4,282,891 H27R probably benign Het
Aox2 A G 1: 58,300,694 N382S probably benign Het
Aspg G A 12: 112,119,972 R220Q probably benign Het
Atg16l2 C A 7: 101,291,986 G403V probably damaging Het
Bcat1 G T 6: 145,010,058 Q299K probably benign Het
Cc2d1b C T 4: 108,626,671 probably benign Het
Cdh26 T C 2: 178,449,891 F81S probably damaging Het
Cnbd2 A G 2: 156,335,402 I222M probably benign Het
Ephb3 T C 16: 21,221,700 V562A probably damaging Het
Fam186a T C 15: 99,940,318 T2682A probably benign Het
Fat2 T C 11: 55,291,870 probably null Het
Fat4 A T 3: 39,007,177 D4303V probably damaging Het
Fbln1 T A 15: 85,231,464 S234T probably benign Het
Gldc G A 19: 30,160,677 probably benign Het
Gli1 A C 10: 127,331,329 V685G probably damaging Het
H2-T22 T C 17: 36,041,577 N152S probably damaging Het
Inpp5d A T 1: 87,665,532 D118V possibly damaging Het
Ints10 A G 8: 68,802,903 I182V possibly damaging Het
Ipcef1 C T 10: 6,935,182 probably null Het
Kcnj3 G T 2: 55,437,886 R229L probably damaging Het
Klf11 C A 12: 24,653,738 D57E probably damaging Het
Krt73 G T 15: 101,802,239 S20* probably null Het
Lactbl1 A G 4: 136,635,876 probably null Het
Mapk10 T C 5: 103,038,621 D45G possibly damaging Het
Mfrp G A 9: 44,103,222 C222Y probably damaging Het
Mga A T 2: 119,964,666 I2944F possibly damaging Het
Msh2 A G 17: 87,680,013 probably null Het
Nckap1l T A 15: 103,482,180 probably null Het
Olfr1034 A G 2: 86,046,989 N169S probably benign Het
Pitpnm1 T A 19: 4,106,964 probably null Het
Sik2 C T 9: 50,995,671 V85I probably damaging Het
Slc26a7 T A 4: 14,552,470 E229V probably benign Het
Tcaim G A 9: 122,818,773 probably null Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Uggt1 C A 1: 36,202,858 A332S probably benign Het
Usp53 A T 3: 122,934,050 L961* probably null Het
Vmn1r223 A T 13: 23,249,667 T144S possibly damaging Het
Wdfy1 G A 1: 79,706,255 R388C probably damaging Het
Zfp995 T A 17: 21,887,340 M1L probably damaging Het
Other mutations in Spty2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Spty2d1 APN 7 46998987 missense probably damaging 1.00
IGL01763:Spty2d1 APN 7 46999848 missense probably damaging 0.99
IGL01988:Spty2d1 APN 7 46997610 missense probably damaging 0.99
IGL02149:Spty2d1 APN 7 47008144 utr 5 prime probably benign
IGL02236:Spty2d1 APN 7 46997612 missense probably benign 0.02
IGL02273:Spty2d1 APN 7 46997573 missense probably damaging 0.97
3-1:Spty2d1 UTSW 7 46998677 missense probably damaging 1.00
R0184:Spty2d1 UTSW 7 46997574 missense possibly damaging 0.94
R0201:Spty2d1 UTSW 7 46997901 nonsense probably null
R2116:Spty2d1 UTSW 7 46996185 missense probably damaging 1.00
R2171:Spty2d1 UTSW 7 46994613 missense probably damaging 1.00
R2898:Spty2d1 UTSW 7 46993352 missense unknown
R3857:Spty2d1 UTSW 7 46998296 missense probably benign 0.04
R4080:Spty2d1 UTSW 7 46998581 missense probably damaging 0.99
R4319:Spty2d1 UTSW 7 46998135 missense probably damaging 0.99
R4732:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R4733:Spty2d1 UTSW 7 46996110 missense probably damaging 1.00
R5317:Spty2d1 UTSW 7 46998301 missense possibly damaging 0.61
R5485:Spty2d1 UTSW 7 46997885 missense possibly damaging 0.76
R5711:Spty2d1 UTSW 7 46998097 missense possibly damaging 0.84
R5761:Spty2d1 UTSW 7 46998284 missense probably damaging 1.00
R6418:Spty2d1 UTSW 7 46998003 missense probably damaging 1.00
R7182:Spty2d1 UTSW 7 46998523 missense probably benign 0.09
R7372:Spty2d1 UTSW 7 46998944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTGGAAGCAAGCTGCCTG -3'
(R):5'- CGCTGCTATGCTGACACTGTTGAG -3'

Sequencing Primer
(F):5'- GCCTCAGTAAGTCAGTGAAGTTC -3'
(R):5'- ACACTGTTGAGGTGATGTGCTC -3'
Posted On2014-04-24