Incidental Mutation 'R1592:Zfp995'
ID175693
Institutional Source Beutler Lab
Gene Symbol Zfp995
Ensembl Gene ENSMUSG00000078546
Gene Namezinc finger protein 995
Synonyms2210404O09Rik
MMRRC Submission 039629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R1592 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21879570-21909926 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 21887340 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000139581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106026] [ENSMUST00000190066]
Predicted Effect probably damaging
Transcript: ENSMUST00000106026
AA Change: M1L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101647
Gene: ENSMUSG00000078546
AA Change: M1L

DomainStartEndE-ValueType
KRAB 13 76 8.19e-20 SMART
ZnF_C2H2 183 205 8.81e-2 SMART
ZnF_C2H2 211 233 3.21e-4 SMART
ZnF_C2H2 239 261 4.72e-2 SMART
ZnF_C2H2 267 289 1.98e-4 SMART
ZnF_C2H2 295 317 5.59e-4 SMART
ZnF_C2H2 323 345 4.24e-4 SMART
ZnF_C2H2 351 373 9.73e-4 SMART
ZnF_C2H2 379 401 5.29e-5 SMART
ZnF_C2H2 407 429 8.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189719
Predicted Effect probably damaging
Transcript: ENSMUST00000190066
AA Change: M1L

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139581
Gene: ENSMUSG00000078546
AA Change: M1L

DomainStartEndE-ValueType
KRAB 13 76 8.19e-20 SMART
ZnF_C2H2 183 205 8.81e-2 SMART
ZnF_C2H2 211 233 3.21e-4 SMART
ZnF_C2H2 239 261 4.72e-2 SMART
ZnF_C2H2 267 289 1.98e-4 SMART
ZnF_C2H2 295 317 5.59e-4 SMART
ZnF_C2H2 323 345 4.24e-4 SMART
ZnF_C2H2 351 373 9.73e-4 SMART
ZnF_C2H2 379 401 5.29e-5 SMART
ZnF_C2H2 407 429 8.02e-5 SMART
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T C 5: 121,645,381 E327G probably damaging Het
Acp5 A T 9: 22,127,851 W189R probably damaging Het
Adamts8 T C 9: 30,943,176 S114P probably damaging Het
Alkbh3 A C 2: 94,008,424 probably null Het
Ankrd13d T C 19: 4,282,891 H27R probably benign Het
Aox2 A G 1: 58,300,694 N382S probably benign Het
Aspg G A 12: 112,119,972 R220Q probably benign Het
Atg16l2 C A 7: 101,291,986 G403V probably damaging Het
Bcat1 G T 6: 145,010,058 Q299K probably benign Het
Cc2d1b C T 4: 108,626,671 probably benign Het
Cdh26 T C 2: 178,449,891 F81S probably damaging Het
Cnbd2 A G 2: 156,335,402 I222M probably benign Het
Ephb3 T C 16: 21,221,700 V562A probably damaging Het
Fam186a T C 15: 99,940,318 T2682A probably benign Het
Fat2 T C 11: 55,291,870 probably null Het
Fat4 A T 3: 39,007,177 D4303V probably damaging Het
Fbln1 T A 15: 85,231,464 S234T probably benign Het
Gldc G A 19: 30,160,677 probably benign Het
Gli1 A C 10: 127,331,329 V685G probably damaging Het
H2-T22 T C 17: 36,041,577 N152S probably damaging Het
Inpp5d A T 1: 87,665,532 D118V possibly damaging Het
Ints10 A G 8: 68,802,903 I182V possibly damaging Het
Ipcef1 C T 10: 6,935,182 probably null Het
Kcnj3 G T 2: 55,437,886 R229L probably damaging Het
Klf11 C A 12: 24,653,738 D57E probably damaging Het
Krt73 G T 15: 101,802,239 S20* probably null Het
Lactbl1 A G 4: 136,635,876 probably null Het
Mapk10 T C 5: 103,038,621 D45G possibly damaging Het
Mfrp G A 9: 44,103,222 C222Y probably damaging Het
Mga A T 2: 119,964,666 I2944F possibly damaging Het
Msh2 A G 17: 87,680,013 probably null Het
Nckap1l T A 15: 103,482,180 probably null Het
Olfr1034 A G 2: 86,046,989 N169S probably benign Het
Pitpnm1 T A 19: 4,106,964 probably null Het
Sik2 C T 9: 50,995,671 V85I probably damaging Het
Slc26a7 T A 4: 14,552,470 E229V probably benign Het
Spty2d1 A T 7: 46,998,889 D97E possibly damaging Het
Tcaim G A 9: 122,818,773 probably null Het
Tdrd3 T A 14: 87,505,886 N417K probably damaging Het
Uggt1 C A 1: 36,202,858 A332S probably benign Het
Usp53 A T 3: 122,934,050 L961* probably null Het
Vmn1r223 A T 13: 23,249,667 T144S possibly damaging Het
Wdfy1 G A 1: 79,706,255 R388C probably damaging Het
Other mutations in Zfp995
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01800:Zfp995 APN 17 21880991 missense possibly damaging 0.64
experienced UTSW 17 21887340 start codon destroyed probably damaging 0.98
wise UTSW 17 21880512 missense probably benign 0.06
R1164:Zfp995 UTSW 17 21879979 missense probably damaging 1.00
R1167:Zfp995 UTSW 17 21879979 missense probably damaging 1.00
R1669:Zfp995 UTSW 17 21879964 missense probably benign 0.12
R1883:Zfp995 UTSW 17 21880641 missense probably benign 0.00
R2044:Zfp995 UTSW 17 21880594 missense probably damaging 1.00
R2906:Zfp995 UTSW 17 21880266 missense probably benign 0.00
R4454:Zfp995 UTSW 17 21879951 missense probably benign 0.17
R4670:Zfp995 UTSW 17 21887339 start codon destroyed probably null 1.00
R5265:Zfp995 UTSW 17 21880623 missense possibly damaging 0.55
R5393:Zfp995 UTSW 17 21880492 missense probably benign 0.01
R5585:Zfp995 UTSW 17 21887358 splice site probably benign
R5735:Zfp995 UTSW 17 21882029 missense probably benign 0.05
R6243:Zfp995 UTSW 17 21880288 missense probably damaging 1.00
R6318:Zfp995 UTSW 17 21880512 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGCTGTGCTTGTCCCATTTGAAG -3'
(R):5'- AATGCTCAGCATCCATGTTAGTCCC -3'

Sequencing Primer
(F):5'- GCTTGTCCCATTTGAAGTGAAAG -3'
(R):5'- GCCTATGACTCTAGTCCTTGAAAG -3'
Posted On2014-04-24