Incidental Mutation 'R1595:Nhsl1'
ID175741
Institutional Source Beutler Lab
Gene Symbol Nhsl1
Ensembl Gene ENSMUSG00000039835
Gene NameNHS-like 1
Synonyms5730409E15Rik, D10Bwg0940e, A630035H13Rik
MMRRC Submission 039632-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1595 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location18318985-18533892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18526348 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1107 (K1107N)
Ref Sequence ENSEMBL: ENSMUSP00000147021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037341] [ENSMUST00000100054] [ENSMUST00000162891] [ENSMUST00000207038]
Predicted Effect probably damaging
Transcript: ENSMUST00000037341
AA Change: K1077N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040799
Gene: ENSMUSG00000039835
AA Change: K1077N

DomainStartEndE-ValueType
Pfam:NHS 258 906 1.6e-246 PFAM
low complexity region 918 938 N/A INTRINSIC
low complexity region 942 950 N/A INTRINSIC
low complexity region 958 970 N/A INTRINSIC
low complexity region 992 1024 N/A INTRINSIC
low complexity region 1171 1197 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
low complexity region 1442 1460 N/A INTRINSIC
low complexity region 1484 1503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100054
AA Change: K1073N

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097631
Gene: ENSMUSG00000039835
AA Change: K1073N

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 7.3e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
low complexity region 938 946 N/A INTRINSIC
low complexity region 954 966 N/A INTRINSIC
low complexity region 988 1020 N/A INTRINSIC
low complexity region 1167 1193 N/A INTRINSIC
low complexity region 1369 1381 N/A INTRINSIC
low complexity region 1438 1456 N/A INTRINSIC
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159299
SMART Domains Protein: ENSMUSP00000124629
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 79 90 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162891
SMART Domains Protein: ENSMUSP00000124072
Gene: ENSMUSG00000039835

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 197 207 N/A INTRINSIC
Pfam:NHS 253 902 2.1e-250 PFAM
low complexity region 914 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207038
AA Change: K1107N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,177,300 probably null Het
Abcc10 G T 17: 46,322,238 P556H probably damaging Het
Abcc9 A T 6: 142,633,095 D914E probably benign Het
Adgrf4 A G 17: 42,667,873 V193A probably benign Het
Adm A T 7: 110,629,091 T160S probably damaging Het
Ammecr1l T C 18: 31,772,120 probably null Het
Angpt2 T C 8: 18,698,113 D377G probably damaging Het
Ankfn1 A G 11: 89,422,767 probably null Het
Arhgap30 T G 1: 171,408,341 M761R probably benign Het
Asb4 T G 6: 5,390,692 N28K probably damaging Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Cd177 A T 7: 24,744,964 D696E probably benign Het
Cd200 G A 16: 45,394,851 T123I probably benign Het
Cfap70 A G 14: 20,447,536 V50A probably benign Het
Chaf1b T C 16: 93,905,099 probably null Het
Chgb A C 2: 132,793,737 D533A probably benign Het
Col12a1 A G 9: 79,602,254 Y3041H probably damaging Het
Crot T C 5: 8,974,186 N337D probably benign Het
Csad G A 15: 102,177,782 A51V probably damaging Het
Cyp2b9 A G 7: 26,200,907 Y380C possibly damaging Het
Dpysl2 G T 14: 66,815,503 A299E probably damaging Het
Efcc1 A G 6: 87,731,458 E189G probably damaging Het
Egfr T C 11: 16,906,847 I940T probably damaging Het
Etnk2 T G 1: 133,373,179 L228R possibly damaging Het
Fitm2 A G 2: 163,469,690 I201T probably benign Het
Foxo1 A T 3: 52,345,954 M513L probably benign Het
Galnt16 A T 12: 80,590,636 K379I probably damaging Het
Gm5689 T C 18: 42,173,389 M7T probably benign Het
Gtf2a1 T A 12: 91,589,549 N6Y probably damaging Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Klhdc8b T A 9: 108,451,163 D30V probably damaging Het
Lrrc7 G A 3: 158,177,277 Q448* probably null Het
Med29 T C 7: 28,392,503 D54G probably damaging Het
Mfn2 T C 4: 147,894,696 T60A probably benign Het
Mroh1 T C 15: 76,433,530 probably benign Het
Mxd1 A T 6: 86,651,471 V149E possibly damaging Het
Naip6 A T 13: 100,299,094 Y974N probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nlrc3 T C 16: 3,965,302 E81G probably benign Het
Olfr119 G T 17: 37,701,113 A148S probably benign Het
Olfr311 G T 11: 58,841,652 M179I probably benign Het
Osbpl5 C T 7: 143,703,218 V392M possibly damaging Het
Pcdhb22 T A 18: 37,520,453 V401E probably damaging Het
Pcm1 T A 8: 41,309,635 H1444Q probably damaging Het
Pdlim2 A G 14: 70,164,744 Y308H probably damaging Het
Phf14 T G 6: 11,988,753 L664R possibly damaging Het
Phkb T C 8: 86,026,553 probably benign Het
Ptchd3 T A 11: 121,830,594 F98I probably damaging Het
Ptprt C T 2: 161,810,549 probably null Het
Rbp3 A T 14: 33,956,198 H701L possibly damaging Het
Rgl1 T C 1: 152,675,023 probably benign Het
Satb1 A T 17: 51,782,701 S373T possibly damaging Het
Scn3a T A 2: 65,498,979 Y769F probably damaging Het
Senp7 A G 16: 56,184,768 I922V probably damaging Het
Serpina3g A G 12: 104,239,272 E90G probably benign Het
Sh3rf2 C T 18: 42,111,288 T273I probably damaging Het
Slc15a3 A G 19: 10,854,311 T350A probably benign Het
Socs5 T C 17: 87,134,195 C188R probably damaging Het
Tacr1 A G 6: 82,403,742 T45A probably benign Het
Th A G 7: 142,897,008 V117A probably benign Het
Thpo C A 16: 20,728,456 D81Y probably damaging Het
Tmem229b-ps A G 10: 53,475,289 noncoding transcript Het
Trpc4 A G 3: 54,315,815 E724G probably benign Het
Ttn T C 2: 76,746,633 T24639A probably damaging Het
Ulk4 A G 9: 121,044,838 S1176P probably damaging Het
Urgcp T C 11: 5,717,447 D297G probably damaging Het
Vmn1r168 G A 7: 23,541,195 G159D probably damaging Het
Vmn1r67 A T 7: 10,447,670 N226I probably benign Het
Vmn2r27 T C 6: 124,231,615 E57G probably benign Het
Zdhhc14 G T 17: 5,493,556 R37L probably benign Het
Zfp512b G A 2: 181,588,436 T499I probably damaging Het
Zmym2 A T 14: 56,920,730 K575N probably benign Het
Other mutations in Nhsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Nhsl1 APN 10 18527609 missense probably benign 0.07
IGL01121:Nhsl1 APN 10 18511710 missense probably damaging 1.00
IGL01775:Nhsl1 APN 10 18524474 missense probably damaging 0.99
IGL02143:Nhsl1 APN 10 18511635 missense possibly damaging 0.74
IGL02606:Nhsl1 APN 10 18511637 missense probably damaging 1.00
IGL02642:Nhsl1 APN 10 18408390 missense possibly damaging 0.96
IGL02866:Nhsl1 APN 10 18527607 missense probably damaging 0.99
IGL03263:Nhsl1 APN 10 18498079 nonsense probably null
IGL03380:Nhsl1 APN 10 18523879 nonsense probably null
PIT4651001:Nhsl1 UTSW 10 18408435 missense probably damaging 0.98
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0046:Nhsl1 UTSW 10 18525669 missense probably damaging 1.00
R0116:Nhsl1 UTSW 10 18525242 nonsense probably null
R0245:Nhsl1 UTSW 10 18525108 missense probably damaging 1.00
R0254:Nhsl1 UTSW 10 18472985 missense probably damaging 1.00
R0288:Nhsl1 UTSW 10 18524046 missense probably damaging 1.00
R0648:Nhsl1 UTSW 10 18531726 missense possibly damaging 0.92
R1055:Nhsl1 UTSW 10 18525475 missense probably benign 0.08
R1300:Nhsl1 UTSW 10 18408461 missense probably benign
R1384:Nhsl1 UTSW 10 18408513 missense probably null 0.96
R1453:Nhsl1 UTSW 10 18531575 missense probably damaging 1.00
R1523:Nhsl1 UTSW 10 18408355 missense probably benign
R1786:Nhsl1 UTSW 10 18524664 missense probably benign 0.28
R1836:Nhsl1 UTSW 10 18524905 missense possibly damaging 0.87
R1878:Nhsl1 UTSW 10 18524279 missense probably damaging 1.00
R2013:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2014:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R2015:Nhsl1 UTSW 10 18511592 missense probably damaging 1.00
R3115:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3116:Nhsl1 UTSW 10 18525168 missense probably damaging 1.00
R3754:Nhsl1 UTSW 10 18516034 missense probably damaging 0.99
R4342:Nhsl1 UTSW 10 18526689 missense probably damaging 1.00
R4595:Nhsl1 UTSW 10 18527609 missense probably benign 0.07
R4604:Nhsl1 UTSW 10 18531410 missense probably damaging 0.99
R4666:Nhsl1 UTSW 10 18531405 missense probably damaging 1.00
R5223:Nhsl1 UTSW 10 18526326 missense probably damaging 1.00
R5258:Nhsl1 UTSW 10 18524322 nonsense probably null
R5707:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R5796:Nhsl1 UTSW 10 18524250 missense probably benign 0.06
R5960:Nhsl1 UTSW 10 18526976 missense probably benign
R6190:Nhsl1 UTSW 10 18470041 intron probably benign
R6272:Nhsl1 UTSW 10 18524505 missense probably benign 0.01
R6677:Nhsl1 UTSW 10 18525862 missense probably damaging 0.98
R6714:Nhsl1 UTSW 10 18524711 missense possibly damaging 0.74
R6765:Nhsl1 UTSW 10 18531314 missense probably benign 0.01
R6892:Nhsl1 UTSW 10 18524343 missense probably damaging 1.00
R7049:Nhsl1 UTSW 10 18531638 missense probably damaging 0.99
R7060:Nhsl1 UTSW 10 18526503 missense probably damaging 1.00
R7236:Nhsl1 UTSW 10 18525764 missense probably damaging 1.00
R7305:Nhsl1 UTSW 10 18531686 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCAGTTAGCCCCTCTCTTCCAAG -3'
(R):5'- GCTCTACTGCACTGTCATGGTCAC -3'

Sequencing Primer
(F):5'- TGTGCCAGCACCTCCAC -3'
(R):5'- TCTTGGCAGGCATCGGAAG -3'
Posted On2014-04-24