Incidental Mutation 'R1595:Csad'
ID175758
Institutional Source Beutler Lab
Gene Symbol Csad
Ensembl Gene ENSMUSG00000023044
Gene Namecysteine sulfinic acid decarboxylase
Synonyms
MMRRC Submission 039632-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1595 (G1)
Quality Score187
Status Validated
Chromosome15
Chromosomal Location102176999-102204724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102177782 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 51 (A51V)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023805] [ENSMUST00000230288] [ENSMUST00000230322] [ENSMUST00000230708] [ENSMUST00000231048]
Predicted Effect probably damaging
Transcript: ENSMUST00000023805
AA Change: A438V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023805
Gene: ENSMUSG00000023044
AA Change: A438V

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 49 417 1.4e-113 PFAM
Pfam:Aminotran_5 120 281 4.9e-7 PFAM
low complexity region 482 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230253
Predicted Effect probably damaging
Transcript: ENSMUST00000230288
AA Change: A408V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000230322
Predicted Effect probably benign
Transcript: ENSMUST00000230342
Predicted Effect probably benign
Transcript: ENSMUST00000230708
Predicted Effect probably damaging
Transcript: ENSMUST00000231029
AA Change: A51V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231048
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.1%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group 2 decarboxylase family. A similar protein in rodents plays a role in multiple biological processes as the rate-limiting enzyme in taurine biosynthesis, catalyzing the decarboxylation of cysteinesulfinate to hypotaurine. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,177,300 probably null Het
Abcc10 G T 17: 46,322,238 P556H probably damaging Het
Abcc9 A T 6: 142,633,095 D914E probably benign Het
Adgrf4 A G 17: 42,667,873 V193A probably benign Het
Adm A T 7: 110,629,091 T160S probably damaging Het
Ammecr1l T C 18: 31,772,120 probably null Het
Angpt2 T C 8: 18,698,113 D377G probably damaging Het
Ankfn1 A G 11: 89,422,767 probably null Het
Arhgap30 T G 1: 171,408,341 M761R probably benign Het
Asb4 T G 6: 5,390,692 N28K probably damaging Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Cd177 A T 7: 24,744,964 D696E probably benign Het
Cd200 G A 16: 45,394,851 T123I probably benign Het
Cfap70 A G 14: 20,447,536 V50A probably benign Het
Chaf1b T C 16: 93,905,099 probably null Het
Chgb A C 2: 132,793,737 D533A probably benign Het
Col12a1 A G 9: 79,602,254 Y3041H probably damaging Het
Crot T C 5: 8,974,186 N337D probably benign Het
Cyp2b9 A G 7: 26,200,907 Y380C possibly damaging Het
Dpysl2 G T 14: 66,815,503 A299E probably damaging Het
Efcc1 A G 6: 87,731,458 E189G probably damaging Het
Egfr T C 11: 16,906,847 I940T probably damaging Het
Etnk2 T G 1: 133,373,179 L228R possibly damaging Het
Fitm2 A G 2: 163,469,690 I201T probably benign Het
Foxo1 A T 3: 52,345,954 M513L probably benign Het
Galnt16 A T 12: 80,590,636 K379I probably damaging Het
Gm5689 T C 18: 42,173,389 M7T probably benign Het
Gtf2a1 T A 12: 91,589,549 N6Y probably damaging Het
Kcnc1 G A 7: 46,427,586 V271M probably benign Het
Klhdc8b T A 9: 108,451,163 D30V probably damaging Het
Lrrc7 G A 3: 158,177,277 Q448* probably null Het
Med29 T C 7: 28,392,503 D54G probably damaging Het
Mfn2 T C 4: 147,894,696 T60A probably benign Het
Mroh1 T C 15: 76,433,530 probably benign Het
Mxd1 A T 6: 86,651,471 V149E possibly damaging Het
Naip6 A T 13: 100,299,094 Y974N probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nhsl1 G T 10: 18,526,348 K1107N probably damaging Het
Nlrc3 T C 16: 3,965,302 E81G probably benign Het
Olfr119 G T 17: 37,701,113 A148S probably benign Het
Olfr311 G T 11: 58,841,652 M179I probably benign Het
Osbpl5 C T 7: 143,703,218 V392M possibly damaging Het
Pcdhb22 T A 18: 37,520,453 V401E probably damaging Het
Pcm1 T A 8: 41,309,635 H1444Q probably damaging Het
Pdlim2 A G 14: 70,164,744 Y308H probably damaging Het
Phf14 T G 6: 11,988,753 L664R possibly damaging Het
Phkb T C 8: 86,026,553 probably benign Het
Ptchd3 T A 11: 121,830,594 F98I probably damaging Het
Ptprt C T 2: 161,810,549 probably null Het
Rbp3 A T 14: 33,956,198 H701L possibly damaging Het
Rgl1 T C 1: 152,675,023 probably benign Het
Satb1 A T 17: 51,782,701 S373T possibly damaging Het
Scn3a T A 2: 65,498,979 Y769F probably damaging Het
Senp7 A G 16: 56,184,768 I922V probably damaging Het
Serpina3g A G 12: 104,239,272 E90G probably benign Het
Sh3rf2 C T 18: 42,111,288 T273I probably damaging Het
Slc15a3 A G 19: 10,854,311 T350A probably benign Het
Socs5 T C 17: 87,134,195 C188R probably damaging Het
Tacr1 A G 6: 82,403,742 T45A probably benign Het
Th A G 7: 142,897,008 V117A probably benign Het
Thpo C A 16: 20,728,456 D81Y probably damaging Het
Tmem229b-ps A G 10: 53,475,289 noncoding transcript Het
Trpc4 A G 3: 54,315,815 E724G probably benign Het
Ttn T C 2: 76,746,633 T24639A probably damaging Het
Ulk4 A G 9: 121,044,838 S1176P probably damaging Het
Urgcp T C 11: 5,717,447 D297G probably damaging Het
Vmn1r168 G A 7: 23,541,195 G159D probably damaging Het
Vmn1r67 A T 7: 10,447,670 N226I probably benign Het
Vmn2r27 T C 6: 124,231,615 E57G probably benign Het
Zdhhc14 G T 17: 5,493,556 R37L probably benign Het
Zfp512b G A 2: 181,588,436 T499I probably damaging Het
Zmym2 A T 14: 56,920,730 K575N probably benign Het
Other mutations in Csad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Csad APN 15 102187163 missense probably damaging 1.00
IGL01769:Csad APN 15 102180081 missense probably benign 0.02
IGL02254:Csad APN 15 102186437 nonsense probably null
dejavu UTSW 15 102179972 missense probably damaging 1.00
dell UTSW 15 102178606 missense probably damaging 1.00
lenovo UTSW 15 102179034 missense probably null 1.00
PIT4382001:Csad UTSW 15 102188650 missense probably benign 0.00
R0701:Csad UTSW 15 102179136 missense probably benign 0.42
R1707:Csad UTSW 15 102179972 missense probably damaging 1.00
R2107:Csad UTSW 15 102179034 missense probably null 1.00
R2196:Csad UTSW 15 102187593 missense probably benign 0.00
R2275:Csad UTSW 15 102187122 missense probably damaging 0.98
R2504:Csad UTSW 15 102188667 start codon destroyed probably null 0.97
R2928:Csad UTSW 15 102177704 missense probably damaging 1.00
R3924:Csad UTSW 15 102178556 missense probably benign 0.05
R6235:Csad UTSW 15 102178606 missense probably damaging 1.00
R6418:Csad UTSW 15 102179523 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGAGAACCCAGGAGACTACGCAG -3'
(R):5'- ACAGCTCAGAAATATGCCGGGAAC -3'

Sequencing Primer
(F):5'- ACTACGCAGAGCTTGGGTG -3'
(R):5'- TGCTGAATATCAGAGACAGGTC -3'
Posted On2014-04-24