Incidental Mutation 'R1597:Lrriq4'
ID175853
Institutional Source Beutler Lab
Gene Symbol Lrriq4
Ensembl Gene ENSMUSG00000027703
Gene Nameleucine-rich repeats and IQ motif containing 4
Synonyms4930558O21Rik
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R1597 (G1)
Quality Score200
Status Validated
Chromosome3
Chromosomal Location30644507-30672431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 30650888 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 355 (P355R)
Ref Sequence ENSEMBL: ENSMUSP00000127052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029252] [ENSMUST00000108265] [ENSMUST00000108267] [ENSMUST00000172350]
Predicted Effect probably benign
Transcript: ENSMUST00000029252
SMART Domains Protein: ENSMUSP00000029252
Gene: ENSMUSG00000027702

DomainStartEndE-ValueType
LRR 73 100 2.23e2 SMART
LRR 101 128 6.92e-1 SMART
LRR 129 156 1.78e0 SMART
LRR 157 184 1.67e-2 SMART
Blast:LRR 216 242 2e-9 BLAST
LRR 244 271 2.57e-3 SMART
LRR 272 299 5.59e-4 SMART
LRR 301 328 4.16e0 SMART
LRR 329 356 1.66e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108265
AA Change: P340R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103900
Gene: ENSMUSG00000027703
AA Change: P340R

DomainStartEndE-ValueType
LRR 68 90 7.05e-1 SMART
LRR 91 114 1.19e1 SMART
Pfam:LRR_7 115 133 1.1e-1 PFAM
LRR 138 161 9.75e0 SMART
LRR 162 185 8.72e0 SMART
LRR 208 230 3.47e0 SMART
LRR 231 254 9.3e-1 SMART
LRR 255 276 1.22e2 SMART
LRR 277 300 4.83e0 SMART
LRR 323 345 6.22e0 SMART
LRR 346 368 6.4e0 SMART
LRR 369 392 1.51e0 SMART
LRR 418 440 2.03e1 SMART
LRR 441 464 2.82e0 SMART
IQ 524 546 8.84e-3 SMART
low complexity region 553 581 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108267
AA Change: P355R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103902
Gene: ENSMUSG00000027703
AA Change: P355R

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
Pfam:LRR_7 130 148 1.2e-1 PFAM
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172350
AA Change: P355R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127052
Gene: ENSMUSG00000027703
AA Change: P355R

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Meta Mutation Damage Score 0.452 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Ap1s1 A T 5: 137,043,241 M20K probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Ddhd2 A G 8: 25,749,741 V315A probably benign Het
Dnah17 C A 11: 118,103,498 probably benign Het
Dock2 T C 11: 34,704,647 T441A probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mcm3ap T C 10: 76,483,226 F763L probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
Mx1 T A 16: 97,455,129 M197L probably damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Olfr68 A G 7: 103,778,060 F95S probably benign Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Psme1 A G 14: 55,580,765 T150A probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tecpr1 A G 5: 144,214,310 I256T probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zfyve16 T A 13: 92,508,247 N1149I probably benign Het
Other mutations in Lrriq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Lrriq4 APN 3 30650955 splice site probably null
IGL01289:Lrriq4 APN 3 30650393 missense probably damaging 1.00
IGL02130:Lrriq4 APN 3 30650747 missense probably damaging 0.99
IGL02614:Lrriq4 APN 3 30655639 missense probably damaging 1.00
R0329:Lrriq4 UTSW 3 30655724 missense probably benign 0.03
R1340:Lrriq4 UTSW 3 30650323 missense possibly damaging 0.46
R1440:Lrriq4 UTSW 3 30650761 missense probably damaging 1.00
R1446:Lrriq4 UTSW 3 30650578 missense probably benign 0.00
R1763:Lrriq4 UTSW 3 30650252 missense probably benign 0.19
R1923:Lrriq4 UTSW 3 30659093 missense probably benign 0.13
R4024:Lrriq4 UTSW 3 30650273 missense possibly damaging 0.46
R4026:Lrriq4 UTSW 3 30650273 missense possibly damaging 0.46
R4645:Lrriq4 UTSW 3 30650743 missense probably benign 0.20
R4816:Lrriq4 UTSW 3 30660047 missense possibly damaging 0.73
R5049:Lrriq4 UTSW 3 30650937 missense probably damaging 0.97
R5105:Lrriq4 UTSW 3 30650483 missense probably damaging 1.00
R5298:Lrriq4 UTSW 3 30645332 start codon destroyed probably null
R5487:Lrriq4 UTSW 3 30659995 missense probably benign 0.16
R6147:Lrriq4 UTSW 3 30659079 missense probably damaging 1.00
R6421:Lrriq4 UTSW 3 30650402 missense probably damaging 1.00
R6452:Lrriq4 UTSW 3 30655733 missense probably damaging 1.00
R6624:Lrriq4 UTSW 3 30650780 missense probably benign 0.01
R7032:Lrriq4 UTSW 3 30655701 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGCTGGATTTGACCCACAACTC -3'
(R):5'- CTGCTGCCTACGTCCTAAGTGAAC -3'

Sequencing Primer
(F):5'- CTCACGGAGGTAGGGCTG -3'
(R):5'- AGGATATGAAGTGCCACCTTGTG -3'
Posted On2014-04-24