Incidental Mutation 'R1597:Tecpr1'
ID175866
Institutional Source Beutler Lab
Gene Symbol Tecpr1
Ensembl Gene ENSMUSG00000066621
Gene Nametectonin beta-propeller repeat containing 1
Synonyms
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1597 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location144194442-144223615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144214310 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 256 (I256T)
Ref Sequence ENSEMBL: ENSMUSP00000082844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085701]
Predicted Effect probably benign
Transcript: ENSMUST00000085701
AA Change: I256T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: I256T

DomainStartEndE-ValueType
TECPR 23 59 8.98e1 SMART
DysFN 64 125 6.72e-24 SMART
DysFC 137 170 1.89e-9 SMART
TECPR 192 225 1.79e-1 SMART
TECPR 234 270 2.5e-9 SMART
TECPR 279 317 4.99e-9 SMART
TECPR 326 361 2.42e-7 SMART
low complexity region 381 394 N/A INTRINSIC
PH 614 724 1.69e-2 SMART
TECPR 711 750 1.88e-4 SMART
TECPR 766 800 3.27e-4 SMART
DysFN 821 882 2.95e-20 SMART
DysFC 893 926 1.66e-14 SMART
TECPR 940 974 1.69e1 SMART
TECPR 983 1019 1.45e-5 SMART
TECPR 1028 1065 1.51e-8 SMART
TECPR 1074 1109 1.59e-2 SMART
low complexity region 1125 1137 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156129
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Ap1s1 A T 5: 137,043,241 M20K probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Ddhd2 A G 8: 25,749,741 V315A probably benign Het
Dnah17 C A 11: 118,103,498 probably benign Het
Dock2 T C 11: 34,704,647 T441A probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Lrriq4 C G 3: 30,650,888 P355R probably damaging Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mcm3ap T C 10: 76,483,226 F763L probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
Mx1 T A 16: 97,455,129 M197L probably damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Olfr68 A G 7: 103,778,060 F95S probably benign Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Psme1 A G 14: 55,580,765 T150A probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zfyve16 T A 13: 92,508,247 N1149I probably benign Het
Other mutations in Tecpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Tecpr1 APN 5 144208593 critical splice donor site probably null
IGL01774:Tecpr1 APN 5 144211540 missense probably damaging 0.97
IGL01960:Tecpr1 APN 5 144216919 missense probably benign 0.00
IGL01973:Tecpr1 APN 5 144197988 splice site probably benign
IGL02244:Tecpr1 APN 5 144210003 missense probably benign
IGL02247:Tecpr1 APN 5 144206554 missense possibly damaging 0.64
IGL02423:Tecpr1 APN 5 144203487 missense possibly damaging 0.88
IGL02679:Tecpr1 APN 5 144206546 missense probably benign 0.28
larghissimo UTSW 5 144217257 missense probably damaging 1.00
R0121:Tecpr1 UTSW 5 144210199 missense probably benign 0.02
R0125:Tecpr1 UTSW 5 144197899 missense probably damaging 1.00
R0194:Tecpr1 UTSW 5 144218517 missense probably damaging 1.00
R0376:Tecpr1 UTSW 5 144207476 missense possibly damaging 0.94
R0441:Tecpr1 UTSW 5 144195941 missense probably benign
R0504:Tecpr1 UTSW 5 144214081 missense probably damaging 0.99
R0538:Tecpr1 UTSW 5 144206274 missense probably damaging 0.99
R0586:Tecpr1 UTSW 5 144217401 missense probably damaging 1.00
R0607:Tecpr1 UTSW 5 144212590 missense probably damaging 1.00
R0608:Tecpr1 UTSW 5 144211499 missense probably damaging 1.00
R0656:Tecpr1 UTSW 5 144214053 splice site probably null
R0835:Tecpr1 UTSW 5 144212592 missense possibly damaging 0.81
R1080:Tecpr1 UTSW 5 144216929 missense probably damaging 1.00
R1394:Tecpr1 UTSW 5 144206539 missense possibly damaging 0.77
R1663:Tecpr1 UTSW 5 144197944 missense probably benign 0.17
R1785:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1786:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R1833:Tecpr1 UTSW 5 144208608 missense probably damaging 0.99
R1883:Tecpr1 UTSW 5 144206529 missense probably benign 0.03
R1988:Tecpr1 UTSW 5 144204697 missense possibly damaging 0.94
R2130:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2131:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2132:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2133:Tecpr1 UTSW 5 144208645 missense probably benign 0.01
R2172:Tecpr1 UTSW 5 144196417 missense probably damaging 1.00
R2172:Tecpr1 UTSW 5 144211456 missense probably benign 0.10
R2290:Tecpr1 UTSW 5 144214063 missense probably damaging 0.99
R3691:Tecpr1 UTSW 5 144209979 missense probably benign 0.10
R4027:Tecpr1 UTSW 5 144206259 missense probably benign 0.41
R4587:Tecpr1 UTSW 5 144212590 missense probably damaging 0.96
R4684:Tecpr1 UTSW 5 144207437 missense probably benign 0.16
R4864:Tecpr1 UTSW 5 144214117 missense probably benign 0.00
R4932:Tecpr1 UTSW 5 144204658 missense probably damaging 0.97
R4955:Tecpr1 UTSW 5 144217257 missense probably damaging 1.00
R5043:Tecpr1 UTSW 5 144197854 intron probably null
R5459:Tecpr1 UTSW 5 144207416 missense probably damaging 1.00
R5579:Tecpr1 UTSW 5 144214344 missense possibly damaging 0.55
R5677:Tecpr1 UTSW 5 144218633 nonsense probably null
R5679:Tecpr1 UTSW 5 144207423 missense possibly damaging 0.69
R5802:Tecpr1 UTSW 5 144206546 missense probably benign 0.28
R6000:Tecpr1 UTSW 5 144211421 missense probably benign 0.02
R6022:Tecpr1 UTSW 5 144199191 missense possibly damaging 0.95
R6114:Tecpr1 UTSW 5 144204640 missense possibly damaging 0.81
R6251:Tecpr1 UTSW 5 144198576 missense probably damaging 0.97
R6372:Tecpr1 UTSW 5 144216958 missense probably damaging 1.00
R6493:Tecpr1 UTSW 5 144209974 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTAACTTCCTGCCAGTCCCCAAAG -3'
(R):5'- GGCCAAAATCCAGGCATTTTCTCAC -3'

Sequencing Primer
(F):5'- AGAAACCCAGGCGGTCTC -3'
(R):5'- TCTCACCAAGATGTGAGTGC -3'
Posted On2014-04-24