Incidental Mutation 'R1597:Ddhd2'
Institutional Source Beutler Lab
Gene Symbol Ddhd2
Ensembl Gene ENSMUSG00000061313
Gene NameDDHD domain containing 2
Synonyms2010305K11Rik, SAMWD1
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R1597 (G1)
Quality Score225
Status Validated
Chromosomal Location25725346-25754596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25749741 bp
Amino Acid Change Valine to Alanine at position 315 (V315A)
Ref Sequence ENSEMBL: ENSMUSP00000147859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033975] [ENSMUST00000211009] [ENSMUST00000211688] [ENSMUST00000211751]
Predicted Effect probably benign
Transcript: ENSMUST00000033975
AA Change: V203A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033975
Gene: ENSMUSG00000061313
AA Change: V203A

low complexity region 12 25 N/A INTRINSIC
Pfam:WWE 40 112 7.5e-9 PFAM
Blast:DDHD 285 357 6e-28 BLAST
SAM 382 447 1.13e-11 SMART
DDHD 484 688 6.63e-75 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167899
SMART Domains Protein: ENSMUSP00000130277
Gene: ENSMUSG00000091514

low complexity region 86 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210843
Predicted Effect probably benign
Transcript: ENSMUST00000210888
Predicted Effect probably benign
Transcript: ENSMUST00000211009
AA Change: V203A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211688
AA Change: V315A

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000211751
AA Change: V37A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme containing sterile-alpha-motif (SAM), WWE, and DDHD domains. This protein participates in membrane trafficking between the endoplastic reticulum and the Golgi body. Mutations in this gene can cause autosomal recessive spastic paraplegia 54. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a null mutation display impaired balance and coordination, impaired spatial learning and memory and triglyceride accumulation in neurons in the brain and spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Ap1s1 A T 5: 137,043,241 M20K probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Dnah17 C A 11: 118,103,498 probably benign Het
Dock2 T C 11: 34,704,647 T441A probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Lrriq4 C G 3: 30,650,888 P355R probably damaging Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mcm3ap T C 10: 76,483,226 F763L probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
Mx1 T A 16: 97,455,129 M197L probably damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Olfr68 A G 7: 103,778,060 F95S probably benign Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Psme1 A G 14: 55,580,765 T150A probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tecpr1 A G 5: 144,214,310 I256T probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zfyve16 T A 13: 92,508,247 N1149I probably benign Het
Other mutations in Ddhd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Ddhd2 APN 8 25735830 missense probably damaging 1.00
IGL01629:Ddhd2 APN 8 25735828 missense possibly damaging 0.91
IGL01656:Ddhd2 APN 8 25727712 missense probably benign 0.34
IGL01723:Ddhd2 APN 8 25735011 nonsense probably null
IGL01820:Ddhd2 APN 8 25749754 missense possibly damaging 0.87
IGL01901:Ddhd2 APN 8 25748594 missense probably damaging 0.96
IGL02619:Ddhd2 APN 8 25746954 critical splice acceptor site probably null
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0240:Ddhd2 UTSW 8 25739590 splice site probably null
R0408:Ddhd2 UTSW 8 25739587 critical splice acceptor site probably null
R0732:Ddhd2 UTSW 8 25741321 missense probably damaging 1.00
R1483:Ddhd2 UTSW 8 25753128 missense probably benign 0.01
R1881:Ddhd2 UTSW 8 25727700 missense probably damaging 0.99
R1927:Ddhd2 UTSW 8 25741661 missense possibly damaging 0.92
R2044:Ddhd2 UTSW 8 25752165 missense probably damaging 1.00
R4494:Ddhd2 UTSW 8 25738234 missense probably benign 0.01
R4728:Ddhd2 UTSW 8 25752267 missense probably damaging 1.00
R5044:Ddhd2 UTSW 8 25752137 missense probably damaging 1.00
R5138:Ddhd2 UTSW 8 25727699 missense probably damaging 1.00
R5529:Ddhd2 UTSW 8 25739560 missense probably benign 0.00
R5761:Ddhd2 UTSW 8 25741699 missense probably benign 0.19
R5799:Ddhd2 UTSW 8 25748602 missense probably damaging 1.00
R5934:Ddhd2 UTSW 8 25753113 missense probably damaging 1.00
R5965:Ddhd2 UTSW 8 25735777 missense probably damaging 1.00
R5988:Ddhd2 UTSW 8 25748562 missense probably damaging 1.00
R6260:Ddhd2 UTSW 8 25752117 missense probably benign 0.00
R6791:Ddhd2 UTSW 8 25752215 missense probably benign 0.04
Predicted Primers PCR Primer
(R):5'- AATGTCTTAAATCgcccacgcct -3'

Sequencing Primer
(F):5'- attattagaaagaaggtgggttgtg -3'
Posted On2014-04-24