Incidental Mutation 'R1597:Mcm3ap'
ID175882
Institutional Source Beutler Lab
Gene Symbol Mcm3ap
Ensembl Gene ENSMUSG00000001150
Gene Nameminichromosome maintenance complex component 3 associated protein
SynonymsGANP
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1597 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76468927-76515857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76483226 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 763 (F763L)
Ref Sequence ENSEMBL: ENSMUSP00000125960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170795]
Predicted Effect probably damaging
Transcript: ENSMUST00000170795
AA Change: F763L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125960
Gene: ENSMUSG00000001150
AA Change: F763L

DomainStartEndE-ValueType
Pfam:NupH_GANP 2 286 3.3e-108 PFAM
low complexity region 389 403 N/A INTRINSIC
Blast:RRM 430 504 5e-39 BLAST
SCOP:d1fjeb2 434 500 6e-4 SMART
low complexity region 544 559 N/A INTRINSIC
low complexity region 570 586 N/A INTRINSIC
Pfam:SAC3_GANP 677 903 1.7e-82 PFAM
low complexity region 997 1008 N/A INTRINSIC
low complexity region 1024 1035 N/A INTRINSIC
low complexity region 1039 1053 N/A INTRINSIC
low complexity region 1091 1110 N/A INTRINSIC
low complexity region 1133 1155 N/A INTRINSIC
Pfam:CID_GANP 1156 1226 1.6e-33 PFAM
Pfam:MCM3AP_GANP 1254 1967 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218881
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220410
Meta Mutation Damage Score 0.604 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The minichromosome maintenance protein 3 (MCM3) is one of the MCM proteins essential for the initiation of DNA replication. The protein encoded by this gene is a MCM3 binding protein. It was reported to have phosphorylation-dependent DNA-primase activity, which was up-regulated in antigen immunization induced germinal center. This protein was demonstrated to be an acetyltransferase that acetylates MCM3 and plays a role in DNA replication. The mutagenesis of a nuclear localization signal of MCM3 affects the binding of this protein with MCM3, suggesting that this protein may also facilitate MCM3 nuclear localization. This gene is expressed in the brain or in neuronal tissue. An allelic variant encoding amino acid Lys at 915, instead of conserved Glu, has been identified in patients with mild intellectual disability. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null allele die by E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Ap1s1 A T 5: 137,043,241 M20K probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Ddhd2 A G 8: 25,749,741 V315A probably benign Het
Dnah17 C A 11: 118,103,498 probably benign Het
Dock2 T C 11: 34,704,647 T441A probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Lrriq4 C G 3: 30,650,888 P355R probably damaging Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
Mx1 T A 16: 97,455,129 M197L probably damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Olfr68 A G 7: 103,778,060 F95S probably benign Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Psme1 A G 14: 55,580,765 T150A probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tecpr1 A G 5: 144,214,310 I256T probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zfyve16 T A 13: 92,508,247 N1149I probably benign Het
Other mutations in Mcm3ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Mcm3ap APN 10 76471177 missense probably benign 0.01
IGL00742:Mcm3ap APN 10 76492935 missense probably damaging 1.00
IGL00898:Mcm3ap APN 10 76470325 missense probably benign 0.00
IGL00984:Mcm3ap APN 10 76499566 missense probably damaging 1.00
IGL01591:Mcm3ap APN 10 76470805 missense probably benign
IGL01882:Mcm3ap APN 10 76483184 missense possibly damaging 0.71
IGL01973:Mcm3ap APN 10 76471117 missense probably benign 0.00
IGL02253:Mcm3ap APN 10 76470065 missense probably benign 0.40
IGL02304:Mcm3ap APN 10 76484738 missense possibly damaging 0.65
IGL02340:Mcm3ap APN 10 76496552 nonsense probably null
IGL02487:Mcm3ap APN 10 76507555 unclassified probably benign
IGL02488:Mcm3ap APN 10 76499649 missense probably damaging 1.00
IGL02640:Mcm3ap APN 10 76506421 missense probably damaging 1.00
IGL02714:Mcm3ap APN 10 76511033 missense probably benign 0.00
IGL02748:Mcm3ap APN 10 76501248 missense probably damaging 1.00
IGL02894:Mcm3ap APN 10 76477767 missense probably benign 0.00
IGL02903:Mcm3ap APN 10 76471258 splice site probably benign
IGL02955:Mcm3ap APN 10 76507466 missense probably benign 0.34
IGL02989:Mcm3ap APN 10 76471060 missense possibly damaging 0.48
IGL03003:Mcm3ap APN 10 76504697 missense probably benign 0.01
IGL03081:Mcm3ap APN 10 76470316 missense possibly damaging 0.86
IGL03218:Mcm3ap APN 10 76482733 missense probably damaging 1.00
IGL03401:Mcm3ap APN 10 76484649 splice site probably benign
psychopomp UTSW 10 76501100 missense probably damaging 0.97
R0105:Mcm3ap UTSW 10 76499534 missense probably damaging 1.00
R0144:Mcm3ap UTSW 10 76481015 missense probably benign 0.44
R0423:Mcm3ap UTSW 10 76502705 missense probably benign 0.00
R0692:Mcm3ap UTSW 10 76483169 missense probably damaging 1.00
R1402:Mcm3ap UTSW 10 76477914 unclassified probably benign
R1441:Mcm3ap UTSW 10 76471166 missense probably benign
R1512:Mcm3ap UTSW 10 76470513 missense probably damaging 1.00
R1533:Mcm3ap UTSW 10 76504287 missense probably damaging 1.00
R1569:Mcm3ap UTSW 10 76483188 missense possibly damaging 0.80
R1590:Mcm3ap UTSW 10 76496541 missense probably benign 0.36
R1743:Mcm3ap UTSW 10 76484674 missense possibly damaging 0.53
R1773:Mcm3ap UTSW 10 76471160 missense probably benign
R1922:Mcm3ap UTSW 10 76507361 missense probably damaging 1.00
R2061:Mcm3ap UTSW 10 76470068 missense probably benign 0.43
R2097:Mcm3ap UTSW 10 76512489 missense probably damaging 1.00
R2436:Mcm3ap UTSW 10 76490057 missense probably damaging 1.00
R3684:Mcm3ap UTSW 10 76489426 missense possibly damaging 0.64
R3690:Mcm3ap UTSW 10 76482679 missense probably damaging 1.00
R3881:Mcm3ap UTSW 10 76506446 missense probably benign 0.21
R4296:Mcm3ap UTSW 10 76507337 missense probably damaging 1.00
R4677:Mcm3ap UTSW 10 76470570 missense probably damaging 1.00
R4786:Mcm3ap UTSW 10 76488466 missense probably benign 0.00
R4882:Mcm3ap UTSW 10 76484661 nonsense probably null
R4907:Mcm3ap UTSW 10 76493441 missense probably damaging 1.00
R5108:Mcm3ap UTSW 10 76502702 missense probably benign 0.04
R5279:Mcm3ap UTSW 10 76507539 missense probably damaging 0.96
R5316:Mcm3ap UTSW 10 76470926 missense possibly damaging 0.89
R5402:Mcm3ap UTSW 10 76483314 missense probably benign 0.04
R5459:Mcm3ap UTSW 10 76496482 nonsense probably null
R5473:Mcm3ap UTSW 10 76502759 missense probably damaging 1.00
R5570:Mcm3ap UTSW 10 76481096 missense possibly damaging 0.89
R5931:Mcm3ap UTSW 10 76471166 missense probably benign
R5939:Mcm3ap UTSW 10 76508361 missense probably benign 0.00
R5950:Mcm3ap UTSW 10 76488419 missense possibly damaging 0.46
R5998:Mcm3ap UTSW 10 76481142 critical splice donor site probably null
R6122:Mcm3ap UTSW 10 76506607 missense probably damaging 1.00
R6192:Mcm3ap UTSW 10 76501100 missense probably damaging 0.97
R6226:Mcm3ap UTSW 10 76515706 missense possibly damaging 0.95
R6293:Mcm3ap UTSW 10 76471478 nonsense probably null
R6669:Mcm3ap UTSW 10 76507337 missense probably damaging 0.98
R6715:Mcm3ap UTSW 10 76489532 missense possibly damaging 0.68
R6759:Mcm3ap UTSW 10 76501314 missense probably benign
R6864:Mcm3ap UTSW 10 76507479 missense probably damaging 1.00
R6870:Mcm3ap UTSW 10 76470215 missense probably benign 0.00
R6935:Mcm3ap UTSW 10 76504253 missense possibly damaging 0.84
R6947:Mcm3ap UTSW 10 76515666 missense probably benign 0.09
X0026:Mcm3ap UTSW 10 76482785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCCCCACTCAGATGATGGAAATG -3'
(R):5'- CCTGACTCAATTTGCCAACTGCAC -3'

Sequencing Primer
(F):5'- CTCAGATGATGGAAATGCGTGTAG -3'
(R):5'- AAGCCCAACTTCTGACTCTG -3'
Posted On2014-04-24