Incidental Mutation 'R1597:Zfyve16'
ID175894
Institutional Source Beutler Lab
Gene Symbol Zfyve16
Ensembl Gene ENSMUSG00000021706
Gene Namezinc finger, FYVE domain containing 16
SynonymsB130024H06Rik
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R1597 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location92487108-92530868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92508247 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1149 (N1149I)
Ref Sequence ENSEMBL: ENSMUSP00000022217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022217]
Predicted Effect probably benign
Transcript: ENSMUST00000022217
AA Change: N1149I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022217
Gene: ENSMUSG00000021706
AA Change: N1149I

DomainStartEndE-ValueType
low complexity region 163 175 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 455 484 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
FYVE 727 794 7.25e-31 SMART
low complexity region 821 838 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1050 1063 N/A INTRINSIC
Pfam:DUF3480 1155 1503 3.3e-169 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156586
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endosomal protein that belongs to the FYVE zinc finger family of proteins. The encoded protein is thought to regulate membrane trafficking in the endosome. This protein functions as a scaffold protein in the transforming growth factor-beta signaling pathway and is involved in positive and negative feedback regulation of the bone morphogenetic protein signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Ap1s1 A T 5: 137,043,241 M20K probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Ddhd2 A G 8: 25,749,741 V315A probably benign Het
Dnah17 C A 11: 118,103,498 probably benign Het
Dock2 T C 11: 34,704,647 T441A probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Lrriq4 C G 3: 30,650,888 P355R probably damaging Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mcm3ap T C 10: 76,483,226 F763L probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
Mx1 T A 16: 97,455,129 M197L probably damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Olfr68 A G 7: 103,778,060 F95S probably benign Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Psme1 A G 14: 55,580,765 T150A probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tecpr1 A G 5: 144,214,310 I256T probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Other mutations in Zfyve16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfyve16 APN 13 92516538 missense possibly damaging 0.56
IGL00737:Zfyve16 APN 13 92521118 nonsense probably null
IGL00741:Zfyve16 APN 13 92524253 missense probably damaging 1.00
IGL00753:Zfyve16 APN 13 92521118 nonsense probably null
IGL01123:Zfyve16 APN 13 92492522 missense probably damaging 1.00
IGL01149:Zfyve16 APN 13 92508283 missense probably damaging 1.00
IGL01414:Zfyve16 APN 13 92522196 missense probably benign 0.04
IGL01771:Zfyve16 APN 13 92522172 missense probably benign 0.38
IGL01889:Zfyve16 APN 13 92522569 missense possibly damaging 0.87
IGL01928:Zfyve16 APN 13 92504498 missense probably damaging 0.97
IGL02524:Zfyve16 APN 13 92504514 missense probably benign 0.19
IGL03102:Zfyve16 APN 13 92511817 missense possibly damaging 0.57
IGL03192:Zfyve16 APN 13 92521240 missense possibly damaging 0.94
R0321:Zfyve16 UTSW 13 92492534 missense probably damaging 0.99
R0548:Zfyve16 UTSW 13 92494944 missense probably benign 0.00
R0555:Zfyve16 UTSW 13 92516520 splice site probably benign
R0616:Zfyve16 UTSW 13 92521129 missense probably damaging 1.00
R0727:Zfyve16 UTSW 13 92493878 missense possibly damaging 0.81
R0730:Zfyve16 UTSW 13 92521477 missense probably damaging 0.98
R1221:Zfyve16 UTSW 13 92508305 missense possibly damaging 0.87
R1297:Zfyve16 UTSW 13 92522332 missense probably benign 0.41
R1635:Zfyve16 UTSW 13 92509020 missense probably damaging 1.00
R1803:Zfyve16 UTSW 13 92504085 missense probably damaging 1.00
R1840:Zfyve16 UTSW 13 92511525 missense possibly damaging 0.79
R1962:Zfyve16 UTSW 13 92522744 missense possibly damaging 0.74
R2029:Zfyve16 UTSW 13 92504477 missense probably damaging 0.98
R2083:Zfyve16 UTSW 13 92524262 missense probably damaging 1.00
R2122:Zfyve16 UTSW 13 92519483 nonsense probably null
R2173:Zfyve16 UTSW 13 92495088 missense probably damaging 0.99
R3822:Zfyve16 UTSW 13 92521261 missense probably damaging 1.00
R3857:Zfyve16 UTSW 13 92494971 missense probably damaging 1.00
R4043:Zfyve16 UTSW 13 92513763 intron probably null
R4056:Zfyve16 UTSW 13 92504549 missense probably damaging 1.00
R4495:Zfyve16 UTSW 13 92488567 missense probably benign 0.25
R4518:Zfyve16 UTSW 13 92521312 missense possibly damaging 0.86
R4835:Zfyve16 UTSW 13 92522185 missense probably benign 0.18
R4862:Zfyve16 UTSW 13 92508256 missense probably damaging 1.00
R4962:Zfyve16 UTSW 13 92513894 missense probably damaging 1.00
R5117:Zfyve16 UTSW 13 92505689 missense possibly damaging 0.95
R5344:Zfyve16 UTSW 13 92521588 missense possibly damaging 0.79
R5358:Zfyve16 UTSW 13 92508263 missense probably benign 0.04
R5407:Zfyve16 UTSW 13 92500284 missense probably damaging 1.00
R5410:Zfyve16 UTSW 13 92521231 missense probably benign 0.08
R5704:Zfyve16 UTSW 13 92504471 splice site probably null
R5731:Zfyve16 UTSW 13 92508193 missense probably benign 0.11
R5808:Zfyve16 UTSW 13 92495055 nonsense probably null
R5828:Zfyve16 UTSW 13 92513902 missense probably damaging 1.00
R5928:Zfyve16 UTSW 13 92522117 missense probably benign 0.01
R6044:Zfyve16 UTSW 13 92522666 nonsense probably null
R6141:Zfyve16 UTSW 13 92511597 missense probably benign 0.00
R6538:Zfyve16 UTSW 13 92504516 missense probably damaging 1.00
R6594:Zfyve16 UTSW 13 92513818 missense probably benign 0.23
R6767:Zfyve16 UTSW 13 92508199 missense probably damaging 1.00
R6942:Zfyve16 UTSW 13 92516631 missense probably benign
R7011:Zfyve16 UTSW 13 92521987 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCGACAACACTAACTCGTCTACT -3'
(R):5'- GTGTATTGGGGCATTCACACTCAGA -3'

Sequencing Primer
(F):5'- tgtgaaggaggaggaccag -3'
(R):5'- GGCATTCACACTCAGAATGTTTC -3'
Posted On2014-04-24