Incidental Mutation 'R1597:Psme1'
ID175896
Institutional Source Beutler Lab
Gene Symbol Psme1
Ensembl Gene ENSMUSG00000022216
Gene Nameproteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
SynonymsPA28a
MMRRC Submission 039634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R1597 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55578123-55581529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55580765 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 150 (T150A)
Ref Sequence ENSEMBL: ENSMUSP00000133366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022826] [ENSMUST00000022828] [ENSMUST00000089619] [ENSMUST00000172738] [ENSMUST00000174259] [ENSMUST00000174484] [ENSMUST00000174563]
Predicted Effect probably benign
Transcript: ENSMUST00000022826
SMART Domains Protein: ENSMUSP00000022826
Gene: ENSMUSG00000022215

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 95 114 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022828
SMART Domains Protein: ENSMUSP00000022828
Gene: ENSMUSG00000022217

DomainStartEndE-ValueType
Pfam:UPF0172 3 191 1.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089619
SMART Domains Protein: ENSMUSP00000087046
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 4.1e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 100 236 2.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135068
Predicted Effect probably damaging
Transcript: ENSMUST00000172738
AA Change: T138A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133867
Gene: ENSMUSG00000022216
AA Change: T138A

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 3.8e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 129 226 3.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174148
Predicted Effect probably damaging
Transcript: ENSMUST00000174259
AA Change: T161A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134735
Gene: ENSMUSG00000022216
AA Change: T161A

DomainStartEndE-ValueType
Pfam:PA28_alpha 8 68 6e-27 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 103 247 9.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174352
SMART Domains Protein: ENSMUSP00000133463
Gene: ENSMUSG00000022217

DomainStartEndE-ValueType
Pfam:UPF0172 1 43 6.3e-11 PFAM
Pfam:UPF0172 41 82 1.2e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174419
AA Change: T6A
Predicted Effect probably damaging
Transcript: ENSMUST00000174484
AA Change: T161A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133883
Gene: ENSMUSG00000022216
AA Change: T161A

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 4.4e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 100 238 7.7e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174563
AA Change: T150A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133366
Gene: ENSMUSG00000022216
AA Change: T150A

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 58 7.5e-18 PFAM
low complexity region 59 87 N/A INTRINSIC
Pfam:PA28_beta 89 173 5.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228834
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acta2 A T 19: 34,252,583 probably benign Het
Afap1l2 T C 19: 56,914,449 N748S probably benign Het
Aox1 T A 1: 58,047,167 I77N probably damaging Het
Ap1s1 A T 5: 137,043,241 M20K probably damaging Het
Atad3a A T 4: 155,751,435 probably null Het
Atp1b1 G T 1: 164,438,320 R291S probably damaging Het
Birc7 T C 2: 180,929,181 V12A possibly damaging Het
Btnl2 T C 17: 34,363,237 V259A probably damaging Het
Cdh11 A T 8: 102,650,711 N434K probably benign Het
Cel G T 2: 28,560,467 probably benign Het
Col10a1 A G 10: 34,395,078 K349E probably damaging Het
Ddhd2 A G 8: 25,749,741 V315A probably benign Het
Dnah17 C A 11: 118,103,498 probably benign Het
Dock2 T C 11: 34,704,647 T441A probably benign Het
Ermap A T 4: 119,183,955 I286N probably damaging Het
Fbxl17 T C 17: 63,487,818 K423R probably damaging Het
Frem2 T C 3: 53,654,519 T856A probably benign Het
Gas6 T C 8: 13,493,901 E64G probably damaging Het
Gzma T A 13: 113,095,797 N190I probably damaging Het
Ifngr1 C T 10: 19,609,342 T363M probably damaging Het
Itga7 A G 10: 128,946,863 T690A probably benign Het
Kif15 A G 9: 122,994,009 E485G probably benign Het
Kif18a A G 2: 109,292,991 I203M probably damaging Het
Klhl1 A T 14: 96,201,211 probably null Het
Lrch3 C T 16: 32,950,411 Q128* probably null Het
Lrriq4 C G 3: 30,650,888 P355R probably damaging Het
Mcm10 A T 2: 4,998,752 H551Q probably damaging Het
Mcm3ap T C 10: 76,483,226 F763L probably damaging Het
Mdc1 T A 17: 35,845,866 V55E probably damaging Het
Me2 A T 18: 73,797,945 N92K probably damaging Het
Mtss1 A G 15: 58,943,711 S667P probably damaging Het
Mup5 A T 4: 61,835,080 Y15N possibly damaging Het
Mx1 T A 16: 97,455,129 M197L probably damaging Het
N4bp2 C T 5: 65,807,140 T844I probably benign Het
Nlrc3 T A 16: 3,963,995 R517W probably damaging Het
Nos3 A T 5: 24,368,997 I227F probably damaging Het
Olfr68 A G 7: 103,778,060 F95S probably benign Het
Pabpc2 A G 18: 39,773,900 N73D probably damaging Het
Pcdhb18 A G 18: 37,491,767 R717G probably benign Het
Pcsk5 T A 19: 17,436,600 M1702L probably benign Het
Plxna2 A C 1: 194,749,306 probably benign Het
Polr2a A G 11: 69,739,929 M1221T possibly damaging Het
Polr2b A G 5: 77,326,101 D384G probably damaging Het
Ppl T A 16: 5,107,574 H67L probably benign Het
Psmd5 A G 2: 34,867,023 L63S probably damaging Het
Rapgef5 C T 12: 117,658,320 R33C probably damaging Het
Rela G A 19: 5,645,331 R295H probably damaging Het
Rpe65 T A 3: 159,614,784 V326E probably damaging Het
Scn5a C A 9: 119,562,497 R43L probably damaging Het
Skida1 T C 2: 18,046,332 probably benign Het
Slc4a4 G A 5: 89,135,728 A469T probably benign Het
Spaca7 G T 8: 12,580,991 E48* probably null Het
Syn3 G T 10: 86,135,044 T238K probably benign Het
Taok1 A G 11: 77,579,800 S60P probably benign Het
Tecpr1 A G 5: 144,214,310 I256T probably benign Het
Tenm4 T A 7: 96,902,989 probably null Het
Tex15 A G 8: 33,571,483 T588A probably damaging Het
Tgfbi T A 13: 56,632,191 probably benign Het
Tmem62 G A 2: 120,984,362 A169T probably benign Het
Tnc A G 4: 64,006,384 S1026P probably benign Het
Tnik T C 3: 28,604,269 S568P probably damaging Het
Trpm6 A T 19: 18,827,524 I947F probably damaging Het
Ttc27 T A 17: 74,863,407 L832Q possibly damaging Het
U2surp C T 9: 95,481,740 probably benign Het
Ube4a A T 9: 44,929,766 D1009E possibly damaging Het
Unc13d T C 11: 116,074,436 E192G probably benign Het
Vmn2r71 T C 7: 85,624,144 V722A possibly damaging Het
Zfp386 T C 12: 116,060,089 S476P probably damaging Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zfyve16 T A 13: 92,508,247 N1149I probably benign Het
Other mutations in Psme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02532:Psme1 APN 14 55581138 nonsense probably null
IGL02867:Psme1 APN 14 55579926 splice site probably benign
IGL02889:Psme1 APN 14 55579926 splice site probably benign
IGL03257:Psme1 APN 14 55580629 missense probably damaging 1.00
R0491:Psme1 UTSW 14 55579921 splice site probably benign
R1078:Psme1 UTSW 14 55580650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTTCTTTGCTCCAAGGTCACTAC -3'
(R):5'- TCTCCATGACCATCAGACGGATCTC -3'

Sequencing Primer
(F):5'- AAGGTCACTACCTGGTTGC -3'
(R):5'- CAGTTAGCCCTGACTTGAAATCTG -3'
Posted On2014-04-24