Incidental Mutation 'R1598:Psg25'
ID175945
Institutional Source Beutler Lab
Gene Symbol Psg25
Ensembl Gene ENSMUSG00000070798
Gene Namepregnancy-specific glycoprotein 25
Synonymscea13
MMRRC Submission 039635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1598 (G1)
Quality Score215
Status Not validated
Chromosome7
Chromosomal Location18519702-18532269 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 18532003 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 16 (Q16*)
Ref Sequence ENSEMBL: ENSMUSP00000092389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094795]
Predicted Effect probably null
Transcript: ENSMUST00000094795
AA Change: Q16*
SMART Domains Protein: ENSMUSP00000092389
Gene: ENSMUSG00000070798
AA Change: Q16*

DomainStartEndE-ValueType
IG 40 141 2.15e-3 SMART
IG 160 261 1.55e0 SMART
IG 280 381 3.59e-5 SMART
IGc2 397 461 1.02e-9 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Cul7 A T 17: 46,663,091 Q1434L probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Mon2 T C 10: 123,016,396 Y1024C probably damaging Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Plce1 A C 19: 38,720,996 D1098A probably damaging Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc2a4 A G 11: 69,945,018 V335A probably benign Het
Slc4a9 G A 18: 36,528,371 W62* probably null Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ttll5 T C 12: 85,863,598 V207A probably damaging Het
Ubr7 G T 12: 102,769,894 M358I probably damaging Het
Urb1 C A 16: 90,777,440 V918F possibly damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Psg25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Psg25 APN 7 18526181 splice site probably benign
IGL00508:Psg25 APN 7 18529731 missense probably benign
IGL01154:Psg25 APN 7 18524699 missense probably benign 0.01
IGL01388:Psg25 APN 7 18529665 missense possibly damaging 0.87
IGL02222:Psg25 APN 7 18529727 missense probably damaging 1.00
IGL02261:Psg25 APN 7 18521343 missense probably benign 0.09
IGL02309:Psg25 APN 7 18526424 missense probably damaging 0.98
IGL02803:Psg25 APN 7 18526287 missense possibly damaging 0.47
IGL03334:Psg25 APN 7 18529774 missense probably benign 0.01
R0711:Psg25 UTSW 7 18529560 nonsense probably null
R1458:Psg25 UTSW 7 18529587 missense probably damaging 1.00
R2064:Psg25 UTSW 7 18521253 missense probably damaging 0.96
R2066:Psg25 UTSW 7 18529562 missense probably damaging 1.00
R4485:Psg25 UTSW 7 18526278 missense probably damaging 1.00
R4499:Psg25 UTSW 7 18524891 missense possibly damaging 0.89
R4514:Psg25 UTSW 7 18529608 nonsense probably null
R4547:Psg25 UTSW 7 18524704 missense probably damaging 1.00
R4604:Psg25 UTSW 7 18529803 missense probably benign 0.05
R4886:Psg25 UTSW 7 18524913 missense probably benign 0.00
R5121:Psg25 UTSW 7 18526536 missense possibly damaging 0.68
R5208:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5267:Psg25 UTSW 7 18524786 missense possibly damaging 0.78
R5376:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5425:Psg25 UTSW 7 18524784 nonsense probably null
R5749:Psg25 UTSW 7 18524851 missense probably damaging 1.00
R6050:Psg25 UTSW 7 18526478 missense probably benign 0.37
R6862:Psg25 UTSW 7 18521398 missense probably benign 0.03
R6962:Psg25 UTSW 7 18529754 missense probably damaging 1.00
R7238:Psg25 UTSW 7 18532202 start gained probably benign
Z1088:Psg25 UTSW 7 18529591 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGATCATGGCAGCCAATGTGAC -3'
(R):5'- GTGCTCCTGCCTGAGAGAAATTCC -3'

Sequencing Primer
(F):5'- CCAATGTGACTGATTTTGAACAGGG -3'
(R):5'- TGCCTGAGAGAAATTCCACTTAGAAG -3'
Posted On2014-04-24