Incidental Mutation 'R1598:Mon2'
ID175963
Institutional Source Beutler Lab
Gene Symbol Mon2
Ensembl Gene ENSMUSG00000034602
Gene NameMON2 homolog, regulator of endosome to Golgi trafficking
Synonyms2610528O22Rik, SF21
MMRRC Submission 039635-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R1598 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location122992060-123076505 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123016396 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1024 (Y1024C)
Ref Sequence ENSEMBL: ENSMUSP00000131052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037557] [ENSMUST00000073792] [ENSMUST00000170935]
Predicted Effect probably damaging
Transcript: ENSMUST00000037557
AA Change: Y1023C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037568
Gene: ENSMUSG00000034602
AA Change: Y1023C

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 844 929 2.4e-21 PFAM
low complexity region 984 1001 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073792
AA Change: Y1024C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073462
Gene: ENSMUSG00000034602
AA Change: Y1024C

DomainStartEndE-ValueType
Pfam:DCB 8 184 3e-72 PFAM
Pfam:Sec7_N 211 384 3.1e-58 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 615 627 N/A INTRINSIC
Pfam:DUF1981 848 929 6.6e-20 PFAM
Pfam:Mon2_C 932 1706 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170935
AA Change: Y1024C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131052
Gene: ENSMUSG00000034602
AA Change: Y1024C

DomainStartEndE-ValueType
low complexity region 119 138 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Pfam:Sec7_N 208 294 6.5e-16 PFAM
Pfam:Sec7_N 299 385 2.6e-16 PFAM
low complexity region 405 438 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
low complexity region 616 628 N/A INTRINSIC
Pfam:DUF1981 845 930 8.1e-22 PFAM
low complexity region 985 1002 N/A INTRINSIC
low complexity region 1183 1194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219241
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222536
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Cul7 A T 17: 46,663,091 Q1434L probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Plce1 A C 19: 38,720,996 D1098A probably damaging Het
Psg25 G A 7: 18,532,003 Q16* probably null Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc2a4 A G 11: 69,945,018 V335A probably benign Het
Slc4a9 G A 18: 36,528,371 W62* probably null Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ttll5 T C 12: 85,863,598 V207A probably damaging Het
Ubr7 G T 12: 102,769,894 M358I probably damaging Het
Urb1 C A 16: 90,777,440 V918F possibly damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Mon2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Mon2 APN 10 123026299 missense probably damaging 1.00
IGL01072:Mon2 APN 10 123010539 nonsense probably null
IGL02080:Mon2 APN 10 123052190 missense probably damaging 0.98
IGL02157:Mon2 APN 10 123013472 missense probably damaging 1.00
IGL02419:Mon2 APN 10 123016447 missense probably benign 0.05
IGL02498:Mon2 APN 10 123034330 missense probably benign 0.00
IGL02638:Mon2 APN 10 123023939 missense probably damaging 1.00
IGL02664:Mon2 APN 10 123009496 splice site probably benign
IGL02690:Mon2 APN 10 123009627 missense possibly damaging 0.67
IGL02878:Mon2 APN 10 123006991 missense probably benign 0.09
IGL03092:Mon2 APN 10 123018100 missense probably damaging 1.00
IGL03103:Mon2 APN 10 123030103 splice site probably benign
IGL03208:Mon2 APN 10 123018069 splice site probably benign
R0010:Mon2 UTSW 10 123032694 missense probably damaging 1.00
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0016:Mon2 UTSW 10 123035546 missense probably damaging 0.96
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0027:Mon2 UTSW 10 123036048 missense possibly damaging 0.66
R0145:Mon2 UTSW 10 123013512 missense possibly damaging 0.94
R0390:Mon2 UTSW 10 123007021 missense probably null 0.05
R0481:Mon2 UTSW 10 123013396 missense possibly damaging 0.94
R0513:Mon2 UTSW 10 123038610 missense probably damaging 1.00
R0599:Mon2 UTSW 10 123026065 splice site probably benign
R1226:Mon2 UTSW 10 123002819 missense probably benign 0.17
R1548:Mon2 UTSW 10 123036007 splice site probably benign
R1650:Mon2 UTSW 10 122995777 missense probably benign 0.45
R1687:Mon2 UTSW 10 123026124 missense probably damaging 0.98
R1721:Mon2 UTSW 10 123031097 missense probably damaging 0.98
R1768:Mon2 UTSW 10 123013763 missense probably benign 0.00
R1827:Mon2 UTSW 10 123046311 missense probably damaging 0.97
R1879:Mon2 UTSW 10 123002885 missense probably damaging 1.00
R1954:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1955:Mon2 UTSW 10 123038483 missense probably damaging 1.00
R1968:Mon2 UTSW 10 123009565 missense probably damaging 1.00
R2060:Mon2 UTSW 10 122995776 missense probably damaging 1.00
R2160:Mon2 UTSW 10 123075929 nonsense probably null
R2165:Mon2 UTSW 10 123042364 splice site probably null
R3737:Mon2 UTSW 10 123013375 missense probably damaging 1.00
R3814:Mon2 UTSW 10 123013565 missense probably damaging 0.98
R4058:Mon2 UTSW 10 123002819 missense probably benign 0.17
R4091:Mon2 UTSW 10 123038510 missense probably damaging 1.00
R4214:Mon2 UTSW 10 123016492 missense probably benign 0.03
R4354:Mon2 UTSW 10 123026983 missense probably benign 0.02
R4422:Mon2 UTSW 10 123042982 missense probably damaging 1.00
R4505:Mon2 UTSW 10 123009589 missense probably damaging 0.99
R4791:Mon2 UTSW 10 123006057 missense probably benign 0.01
R4797:Mon2 UTSW 10 123016517 missense probably benign 0.45
R4944:Mon2 UTSW 10 123038459 critical splice donor site probably null
R4982:Mon2 UTSW 10 122995789 missense probably damaging 1.00
R5298:Mon2 UTSW 10 123010606 missense probably benign
R5503:Mon2 UTSW 10 123032645 missense possibly damaging 0.54
R5653:Mon2 UTSW 10 123026094 missense probably damaging 0.96
R5687:Mon2 UTSW 10 123008239 missense probably damaging 0.99
R5838:Mon2 UTSW 10 123010492 critical splice donor site probably null
R6108:Mon2 UTSW 10 123032695 missense probably benign 0.00
R6182:Mon2 UTSW 10 123038659 splice site probably null
R6355:Mon2 UTSW 10 123022920 missense possibly damaging 0.58
R6358:Mon2 UTSW 10 123013504 missense probably damaging 0.98
R6548:Mon2 UTSW 10 123036093 missense probably damaging 1.00
R6557:Mon2 UTSW 10 123016402 missense probably damaging 1.00
R6649:Mon2 UTSW 10 123038480 missense possibly damaging 0.46
X0022:Mon2 UTSW 10 123006102 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACACTCATGCGTCCACATGCATAT -3'
(R):5'- GCGCTGATGAGGGAAATGCTTGTA -3'

Sequencing Primer
(F):5'- agttcagttcccagcaacc -3'
(R):5'- GATGAGGGAAATGCTTGTATTGAATC -3'
Posted On2014-04-24