Incidental Mutation 'R1598:Slc2a4'
ID175965
Institutional Source Beutler Lab
Gene Symbol Slc2a4
Ensembl Gene ENSMUSG00000018566
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 4
SynonymsGlut-4, Glut4
MMRRC Submission 039635-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.396) question?
Stock #R1598 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69942539-69948188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69945018 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 335 (V335A)
Ref Sequence ENSEMBL: ENSMUSP00000136806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018698] [ENSMUST00000018710] [ENSMUST00000108601] [ENSMUST00000135437] [ENSMUST00000141837] [ENSMUST00000142500] [ENSMUST00000149194] [ENSMUST00000178363] [ENSMUST00000179298]
Predicted Effect probably benign
Transcript: ENSMUST00000018698
SMART Domains Protein: ENSMUSP00000018698
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 2 68 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
CSP 96 164 2.54e-21 SMART
low complexity region 173 212 N/A INTRINSIC
low complexity region 220 242 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000018710
AA Change: V335A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000018710
Gene: ENSMUSG00000018566
AA Change: V335A

DomainStartEndE-ValueType
Pfam:MFS_1 24 436 3.9e-16 PFAM
Pfam:Sugar_tr 27 483 1.7e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108601
SMART Domains Protein: ENSMUSP00000104242
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
CSP 19 87 2.54e-21 SMART
low complexity region 96 135 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 197 217 N/A INTRINSIC
low complexity region 240 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130377
Predicted Effect probably benign
Transcript: ENSMUST00000135437
SMART Domains Protein: ENSMUSP00000137092
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 57 5.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141837
AA Change: V335A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136806
Gene: ENSMUSG00000018566
AA Change: V335A

DomainStartEndE-ValueType
Pfam:MFS_1 24 438 4.7e-17 PFAM
Pfam:Sugar_tr 26 453 6e-140 PFAM
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148395
Predicted Effect probably benign
Transcript: ENSMUST00000149194
SMART Domains Protein: ENSMUSP00000136684
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 122 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152487
Predicted Effect probably benign
Transcript: ENSMUST00000178363
SMART Domains Protein: ENSMUSP00000136455
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
PDB:4PYP|A 14 50 3e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178809
Predicted Effect probably benign
Transcript: ENSMUST00000179298
SMART Domains Protein: ENSMUSP00000136726
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 26 242 6.9e-65 PFAM
Pfam:MFS_1 27 239 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired glucose metabolism in skeletal muscle and adipose tissue. Mice homozygous for a knock-out allele show premature death associated with cardiac hypertrophy, growth retardation, insulin resistance, reduced adipose tissue deposits, and muscle fatigue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Cul7 A T 17: 46,663,091 Q1434L probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Mon2 T C 10: 123,016,396 Y1024C probably damaging Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Plce1 A C 19: 38,720,996 D1098A probably damaging Het
Psg25 G A 7: 18,532,003 Q16* probably null Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc4a9 G A 18: 36,528,371 W62* probably null Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ttll5 T C 12: 85,863,598 V207A probably damaging Het
Ubr7 G T 12: 102,769,894 M358I probably damaging Het
Urb1 C A 16: 90,777,440 V918F possibly damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Slc2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc2a4 APN 11 69945956 splice site probably benign
IGL01448:Slc2a4 APN 11 69945076 missense possibly damaging 0.80
IGL01593:Slc2a4 APN 11 69944828 missense probably damaging 0.98
IGL02188:Slc2a4 APN 11 69946330 start codon destroyed probably null 0.00
IGL02738:Slc2a4 APN 11 69946114 missense probably damaging 1.00
R0282:Slc2a4 UTSW 11 69946355 missense probably damaging 1.00
R0317:Slc2a4 UTSW 11 69946356 missense probably damaging 1.00
R0709:Slc2a4 UTSW 11 69946159 missense possibly damaging 0.92
R1800:Slc2a4 UTSW 11 69946307 missense probably benign 0.08
R1885:Slc2a4 UTSW 11 69945007 missense probably benign 0.03
R1893:Slc2a4 UTSW 11 69946572 missense probably damaging 1.00
R2439:Slc2a4 UTSW 11 69945625 missense possibly damaging 0.93
R2847:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2849:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2865:Slc2a4 UTSW 11 69946116 missense probably damaging 1.00
R3001:Slc2a4 UTSW 11 69945925 nonsense probably null
R3002:Slc2a4 UTSW 11 69945925 nonsense probably null
R4455:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4456:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4463:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4622:Slc2a4 UTSW 11 69944774 unclassified probably benign
R4822:Slc2a4 UTSW 11 69946587 missense probably damaging 1.00
R5695:Slc2a4 UTSW 11 69946391 missense probably damaging 1.00
R6348:Slc2a4 UTSW 11 69945022 missense probably benign 0.03
X0067:Slc2a4 UTSW 11 69944256 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACGGTCATCAAGATGGCACAGC -3'
(R):5'- AAGTCACCGCCTCCATTAGCATTC -3'

Sequencing Primer
(F):5'- CCAGGCCCAACAGATGGAG -3'
(R):5'- TCCATTAGCATTCAGGCTCAG -3'
Posted On2014-04-24