Incidental Mutation 'R1598:Slc4a9'
ID175988
Institutional Source Beutler Lab
Gene Symbol Slc4a9
Ensembl Gene ENSMUSG00000024485
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 9
SynonymsAE4, D630024F24Rik
MMRRC Submission 039635-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R1598 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36528157-36541293 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 36528371 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 62 (W62*)
Ref Sequence ENSEMBL: ENSMUSP00000111358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074298] [ENSMUST00000115694]
Predicted Effect probably null
Transcript: ENSMUST00000074298
AA Change: W62*
SMART Domains Protein: ENSMUSP00000073910
Gene: ENSMUSG00000024485
AA Change: W62*

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 174 4.6e-19 PFAM
Pfam:Band_3_cyto 161 300 7.1e-45 PFAM
Pfam:HCO3_cotransp 367 788 2.7e-168 PFAM
transmembrane domain 794 816 N/A INTRINSIC
low complexity region 830 853 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115694
AA Change: W62*
SMART Domains Protein: ENSMUSP00000111358
Gene: ENSMUSG00000024485
AA Change: W62*

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:Band_3_cyto 80 170 1.9e-15 PFAM
Pfam:Band_3_cyto 159 300 1e-38 PFAM
Pfam:HCO3_cotransp 349 805 3.1e-174 PFAM
Pfam:HCO3_cotransp 801 837 1.1e-11 PFAM
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 879 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in anion exchange. Expression of this gene is mostly limited to the kidney. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered ion exchange in intestinal epithelia and kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik G A 11: 80,364,012 Q328* probably null Het
Adamts1 G A 16: 85,798,511 Q260* probably null Het
Add2 A T 6: 86,098,646 Y259F probably benign Het
Bora T C 14: 99,068,404 V403A probably benign Het
Ccdc144b C T 3: 36,018,997 A379T probably damaging Het
Ccnl1 G A 3: 65,946,770 R477W probably damaging Het
Cdc25a CG CGG 9: 109,879,893 probably null Het
Cdr2l T C 11: 115,393,377 S180P probably damaging Het
Cep290 T A 10: 100,549,329 L1889Q probably damaging Het
Ces4a T C 8: 105,142,821 V208A probably damaging Het
Col2a1 T C 15: 97,979,250 D1049G probably damaging Het
Coro1a A T 7: 126,701,692 N154K possibly damaging Het
Cubn T A 2: 13,469,789 R401S probably benign Het
Cul7 A T 17: 46,663,091 Q1434L probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dars G T 1: 128,373,972 D308E probably benign Het
Dna2 T A 10: 62,961,657 F604I probably damaging Het
Dnah1 T G 14: 31,301,262 I1033L probably benign Het
Dusp27 G A 1: 166,110,259 T77I probably benign Het
Erlin1 T C 19: 44,047,673 E206G probably damaging Het
Esrp2 T A 8: 106,133,273 E345D probably damaging Het
Foxa1 T C 12: 57,542,687 D249G possibly damaging Het
Ghsr C A 3: 27,372,277 L161M probably benign Het
Gm436 T A 4: 144,670,424 K246I possibly damaging Het
Gpr155 C A 2: 73,370,090 V358F probably damaging Het
H2-Eb2 A T 17: 34,334,374 N178I probably damaging Het
Hydin T A 8: 110,410,674 I703N possibly damaging Het
Kctd15 A G 7: 34,641,992 V170A probably damaging Het
Klhl31 A T 9: 77,651,016 Y338F possibly damaging Het
Krt5 C T 15: 101,712,441 A124T probably benign Het
Krt72 T A 15: 101,780,253 I331F probably benign Het
Lrp1b T A 2: 41,511,478 D388V probably damaging Het
Ly9 A G 1: 171,596,507 V382A probably benign Het
Mon2 T C 10: 123,016,396 Y1024C probably damaging Het
Myh14 A G 7: 44,638,394 F572L probably damaging Het
Myh3 A T 11: 67,093,171 D987V probably damaging Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nphp4 A G 4: 152,562,090 T1360A probably benign Het
Olfr1034 C T 2: 86,047,313 T277I probably damaging Het
Olfr1151 T A 2: 87,857,751 I192K probably benign Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Oog4 A G 4: 143,438,001 L320P probably damaging Het
Pcnx2 T C 8: 125,772,086 N1558S probably benign Het
Pde10a A G 17: 8,929,144 E147G probably damaging Het
Pgbd5 T A 8: 124,374,287 H410L probably benign Het
Plce1 A C 19: 38,720,996 D1098A probably damaging Het
Psg25 G A 7: 18,532,003 Q16* probably null Het
Psmd9 T A 5: 123,241,917 V133E probably damaging Het
Rabgap1 C T 2: 37,561,899 S937F probably damaging Het
Rbck1 A G 2: 152,323,170 probably null Het
Rprd2 C G 3: 95,818,739 probably benign Het
Rrs1 A G 1: 9,545,912 N130S probably benign Het
Scmh1 A T 4: 120,515,130 I377F possibly damaging Het
Skor1 G T 9: 63,146,004 R228S probably damaging Het
Slc2a4 A G 11: 69,945,018 V335A probably benign Het
Taar9 G T 10: 24,109,407 A43D possibly damaging Het
Tns4 T C 11: 99,070,417 Y645C probably damaging Het
Tpcn2 G T 7: 145,277,220 Y129* probably null Het
Trpm3 T C 19: 22,733,024 S278P possibly damaging Het
Ttc3 T C 16: 94,422,297 W615R probably damaging Het
Ttll5 T C 12: 85,863,598 V207A probably damaging Het
Ubr7 G T 12: 102,769,894 M358I probably damaging Het
Urb1 C A 16: 90,777,440 V918F possibly damaging Het
Vmn2r51 G A 7: 10,105,505 T52I probably benign Het
Vmn2r95 A T 17: 18,452,313 I771F probably benign Het
Wfdc16 T C 2: 164,635,430 S107G probably benign Het
Zmym2 A G 14: 56,902,769 T22A possibly damaging Het
Zmym2 G A 14: 56,914,067 G470R probably damaging Het
Other mutations in Slc4a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Slc4a9 APN 18 36539596 splice site probably benign
IGL01890:Slc4a9 APN 18 36529707 missense possibly damaging 0.63
IGL01995:Slc4a9 APN 18 36539775 missense possibly damaging 0.64
IGL02293:Slc4a9 APN 18 36533215 missense probably benign 0.00
IGL02476:Slc4a9 APN 18 36535445 critical splice donor site probably null
IGL02690:Slc4a9 APN 18 36531987 missense probably damaging 1.00
IGL02726:Slc4a9 APN 18 36539617 missense probably benign 0.24
IGL03003:Slc4a9 APN 18 36536893 missense probably damaging 1.00
IGL03344:Slc4a9 APN 18 36535601 missense probably damaging 1.00
IGL03410:Slc4a9 APN 18 36529687 missense probably benign
R0025:Slc4a9 UTSW 18 36531666 splice site probably benign
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36533680 missense probably damaging 1.00
R0242:Slc4a9 UTSW 18 36541233 missense probably damaging 1.00
R0330:Slc4a9 UTSW 18 36535539 missense probably damaging 1.00
R0457:Slc4a9 UTSW 18 36535418 missense probably damaging 1.00
R0831:Slc4a9 UTSW 18 36535278 splice site probably benign
R0989:Slc4a9 UTSW 18 36536867 nonsense probably null
R1016:Slc4a9 UTSW 18 36531425 missense probably benign 0.12
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1469:Slc4a9 UTSW 18 36531101 missense probably benign
R1710:Slc4a9 UTSW 18 36532022 missense probably benign
R2041:Slc4a9 UTSW 18 36530793 missense possibly damaging 0.93
R2216:Slc4a9 UTSW 18 36530745 missense probably benign 0.05
R3899:Slc4a9 UTSW 18 36535563 missense probably benign 0.09
R5236:Slc4a9 UTSW 18 36530847 missense probably benign
R5902:Slc4a9 UTSW 18 36529333 splice site probably null
R5902:Slc4a9 UTSW 18 36531507 missense probably damaging 1.00
R5978:Slc4a9 UTSW 18 36535403 missense probably damaging 1.00
R6438:Slc4a9 UTSW 18 36535687 missense probably benign 0.00
R6452:Slc4a9 UTSW 18 36531459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTTTCCAGGATGAAGCTGCC -3'
(R):5'- TTTTCCTCGAACAGCAGCCACC -3'

Sequencing Primer
(F):5'- CCAGGGCAGGGGGATTTTG -3'
(R):5'- TGCCATTGACCCAGTGATACAG -3'
Posted On2014-04-24