Incidental Mutation 'R1599:Adam3'
ID176036
Institutional Source Beutler Lab
Gene Symbol Adam3
Ensembl Gene ENSMUSG00000031553
Gene Namea disintegrin and metallopeptidase domain 3 (cyritestin)
SynonymsADAM3, Taz83, Taz83, Cyrn1, tMDC
MMRRC Submission 039636-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24677225-24725852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24725361 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 20 (D20G)
Ref Sequence ENSEMBL: ENSMUSP00000132620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033958] [ENSMUST00000050300] [ENSMUST00000167703] [ENSMUST00000169598] [ENSMUST00000170318] [ENSMUST00000171438] [ENSMUST00000171611]
Predicted Effect probably benign
Transcript: ENSMUST00000033958
AA Change: D20G

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033958
Gene: ENSMUSG00000031553
AA Change: D20G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 144 3.8e-30 PFAM
Pfam:Reprolysin_5 185 361 6.8e-9 PFAM
Pfam:Reprolysin 187 384 1.6e-64 PFAM
Pfam:Reprolysin_3 211 333 1.2e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050300
SMART Domains Protein: ENSMUSP00000052661
Gene: ENSMUSG00000031554

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pep_M12B_propep 16 142 1.6e-19 PFAM
Pfam:Reprolysin 185 378 7.7e-59 PFAM
DISIN 397 474 9.1e-42 SMART
ACR 475 618 6.9e-58 SMART
transmembrane domain 695 712 N/A INTRINSIC
low complexity region 718 751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130939
Predicted Effect probably benign
Transcript: ENSMUST00000132180
SMART Domains Protein: ENSMUSP00000121272
Gene: ENSMUSG00000031554

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 1 60 6.7e-14 PFAM
Pfam:Reprolysin 103 296 2.5e-61 PFAM
DISIN 315 392 1.78e-39 SMART
ACR 393 536 2.06e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166986
Predicted Effect probably benign
Transcript: ENSMUST00000167703
AA Change: D20G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132634
Gene: ENSMUSG00000031553
AA Change: D20G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168662
Predicted Effect probably benign
Transcript: ENSMUST00000169598
AA Change: D20G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130818
Gene: ENSMUSG00000031553
AA Change: D20G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 90 3.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170318
AA Change: D20G

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132620
Gene: ENSMUSG00000031553
AA Change: D20G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 118 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170740
Predicted Effect probably benign
Transcript: ENSMUST00000171438
AA Change: D20G

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132651
Gene: ENSMUSG00000031553
AA Change: D20G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 23 144 2.4e-22 PFAM
Pfam:Reprolysin_5 185 361 7.8e-9 PFAM
Pfam:Reprolysin 187 384 4.1e-64 PFAM
Pfam:Reprolysin_3 211 321 1e-8 PFAM
DISIN 404 482 5.58e-32 SMART
ACR 483 614 4.1e-50 SMART
EGF 622 653 1.66e1 SMART
transmembrane domain 689 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171611
AA Change: D20G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126617
Gene: ENSMUSG00000031553
AA Change: D20G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Pep_M12B_propep 26 144 2.5e-30 PFAM
Pfam:Reprolysin_5 185 352 6.5e-9 PFAM
Pfam:Reprolysin 187 352 2.1e-54 PFAM
Pfam:Reprolysin_3 211 335 7.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are male infertile, due to the inability of the sperm to bind to the zona pellucida. If the zona pellucida is removed sperm-egg membrane fusion happens as expected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Adam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Adam3 APN 8 24694278 missense probably damaging 1.00
IGL01792:Adam3 APN 8 24697203 missense probably benign 0.27
IGL01894:Adam3 APN 8 24687938 missense probably benign 0.33
IGL01941:Adam3 APN 8 24681446 utr 3 prime probably benign
IGL02355:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02362:Adam3 APN 8 24697191 missense probably damaging 1.00
IGL02511:Adam3 APN 8 24695176 missense probably damaging 0.98
IGL03070:Adam3 APN 8 24703784 missense probably damaging 1.00
IGL03106:Adam3 APN 8 24715119 splice site probably benign
IGL03238:Adam3 APN 8 24687965 unclassified probably null
I2288:Adam3 UTSW 8 24684661 missense probably damaging 1.00
R0511:Adam3 UTSW 8 24695315 missense probably damaging 1.00
R1103:Adam3 UTSW 8 24714271 splice site probably benign
R1104:Adam3 UTSW 8 24681529 missense probably benign 0.10
R1430:Adam3 UTSW 8 24714271 splice site probably benign
R1663:Adam3 UTSW 8 24687933 missense probably benign 0.03
R2023:Adam3 UTSW 8 24689463 missense possibly damaging 0.93
R2278:Adam3 UTSW 8 24711384 missense probably damaging 0.99
R3033:Adam3 UTSW 8 24694211 missense probably benign 0.00
R3440:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3441:Adam3 UTSW 8 24680743 utr 3 prime probably benign
R3688:Adam3 UTSW 8 24703848 missense probably benign 0.02
R4478:Adam3 UTSW 8 24695155 missense probably benign 0.04
R4654:Adam3 UTSW 8 24703803 missense probably damaging 1.00
R4811:Adam3 UTSW 8 24711724 missense probably benign 0.10
R4910:Adam3 UTSW 8 24694305 missense probably benign 0.03
R4921:Adam3 UTSW 8 24684614 missense probably benign 0.01
R4941:Adam3 UTSW 8 24677316 unclassified probably benign
R5239:Adam3 UTSW 8 24694191 missense possibly damaging 0.62
R5771:Adam3 UTSW 8 24707411 missense probably benign 0.00
R5897:Adam3 UTSW 8 24697228 missense probably benign 0.00
R5916:Adam3 UTSW 8 24684539 critical splice donor site probably null
R5979:Adam3 UTSW 8 24677367 missense probably benign 0.03
R6168:Adam3 UTSW 8 24681614 splice site probably null
R6189:Adam3 UTSW 8 24711336 missense probably benign 0.01
R6801:Adam3 UTSW 8 24684664 missense possibly damaging 0.61
R6997:Adam3 UTSW 8 24681523 missense probably benign 0.10
R7065:Adam3 UTSW 8 24711675 critical splice donor site probably null
R7074:Adam3 UTSW 8 24694347 missense probably benign 0.01
R7151:Adam3 UTSW 8 24695255 missense probably damaging 1.00
R7208:Adam3 UTSW 8 24711401 missense probably damaging 0.98
X0063:Adam3 UTSW 8 24711706 missense probably damaging 0.96
Z1088:Adam3 UTSW 8 24681431 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGAAAACCGAGACCTTTGCCCTG -3'
(R):5'- AAGATCGTTGACCCTCCTTTGCTG -3'

Sequencing Primer
(F):5'- TGCCTCAGATCAACAATCTTTATCAC -3'
(R):5'- CCTTTGCTGAGAACATCTGTAAAGTG -3'
Posted On2014-04-24