Incidental Mutation 'R1599:Olfr850'
ID176040
Institutional Source Beutler Lab
Gene Symbol Olfr850
Ensembl Gene ENSMUSG00000094535
Gene Nameolfactory receptor 850
SynonymsGA_x6K02T2PVTD-13214162-13213224, MOR147-2
MMRRC Submission 039636-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19477301-19478248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19478221 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 7 (T7S)
Ref Sequence ENSEMBL: ENSMUSP00000148623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077347] [ENSMUST00000211832]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077347
AA Change: T10S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076569
Gene: ENSMUSG00000094535
AA Change: T10S

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:7tm_4 34 311 1.8e-51 PFAM
Pfam:7TM_GPCR_Srsx 38 304 1e-6 PFAM
Pfam:7tm_1 44 293 5.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211832
AA Change: T7S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Olfr850
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02723:Olfr850 APN 9 19477509 missense probably damaging 1.00
IGL03294:Olfr850 APN 9 19477989 missense possibly damaging 0.95
PIT4305001:Olfr850 UTSW 9 19478061 missense probably damaging 1.00
R0364:Olfr850 UTSW 9 19477972 nonsense probably null
R0379:Olfr850 UTSW 9 19477480 missense possibly damaging 0.75
R0449:Olfr850 UTSW 9 19478092 missense possibly damaging 0.89
R0682:Olfr850 UTSW 9 19477349 missense probably benign 0.03
R0693:Olfr850 UTSW 9 19477972 nonsense probably null
R1484:Olfr850 UTSW 9 19478127 missense probably damaging 1.00
R1626:Olfr850 UTSW 9 19478199 missense probably damaging 1.00
R1742:Olfr850 UTSW 9 19478041 missense probably damaging 1.00
R4232:Olfr850 UTSW 9 19477726 missense probably damaging 0.98
R4237:Olfr850 UTSW 9 19477597 missense probably benign 0.00
R5116:Olfr850 UTSW 9 19477798 missense possibly damaging 0.67
R5643:Olfr850 UTSW 9 19477557 missense probably benign 0.22
R6271:Olfr850 UTSW 9 19478041 missense probably damaging 1.00
R6815:Olfr850 UTSW 9 19477765 missense probably benign 0.20
R7222:Olfr850 UTSW 9 19477467 missense probably damaging 1.00
X0058:Olfr850 UTSW 9 19478223 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCAGCATCTTTGGGATCGTGCTTG -3'
(R):5'- GCTGGGAGGCAGTCTGTGATAATC -3'

Sequencing Primer
(F):5'- ATCGTGCTTGTGCTTAAACAG -3'
(R):5'- catcctgatctttatgctggtttc -3'
Posted On2014-04-24