Incidental Mutation 'R1599:Adgrg6'
ID176050
Institutional Source Beutler Lab
Gene Symbol Adgrg6
Ensembl Gene ENSMUSG00000039116
Gene Nameadhesion G protein-coupled receptor G6
SynonymsLOC215798, 1190004A11Rik, DREG, Gpr126
MMRRC Submission 039636-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location14402583-14545659 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 14467313 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 297 (R297*)
Ref Sequence ENSEMBL: ENSMUSP00000146821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041168] [ENSMUST00000208429]
Predicted Effect probably null
Transcript: ENSMUST00000041168
AA Change: R297*
SMART Domains Protein: ENSMUSP00000043055
Gene: ENSMUSG00000039116
AA Change: R297*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CUB 41 149 8.59e-33 SMART
low complexity region 609 620 N/A INTRINSIC
low complexity region 695 706 N/A INTRINSIC
GPS 769 822 2.48e-12 SMART
Pfam:7tm_2 831 1080 4.1e-52 PFAM
low complexity region 1122 1154 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208429
AA Change: R297*
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which is upregulated in human umbilical vein endothelial cells, encodes a G protein-coupled receptor. Variations in this gene can affect a person's stature. Multiple transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation die during organogenesis and display signs of circulatory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Adgrg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Adgrg6 APN 10 14467450 missense probably damaging 0.99
IGL00428:Adgrg6 APN 10 14467375 missense probably benign
IGL00489:Adgrg6 APN 10 14440403 splice site probably null
IGL00496:Adgrg6 APN 10 14450578 critical splice donor site probably null
IGL00743:Adgrg6 APN 10 14535959 splice site probably benign
IGL01011:Adgrg6 APN 10 14409798 missense probably damaging 0.96
IGL01291:Adgrg6 APN 10 14410530 missense possibly damaging 0.92
IGL01453:Adgrg6 APN 10 14420458 missense possibly damaging 0.94
IGL01594:Adgrg6 APN 10 14434340 missense probably damaging 1.00
IGL02013:Adgrg6 APN 10 14426811 missense probably damaging 0.98
IGL02037:Adgrg6 APN 10 14441441 missense probably damaging 0.98
IGL02070:Adgrg6 APN 10 14467592 missense probably damaging 1.00
IGL02164:Adgrg6 APN 10 14523555 intron probably benign
IGL02262:Adgrg6 APN 10 14441396 missense probably benign 0.00
IGL02272:Adgrg6 APN 10 14468829 missense probably damaging 1.00
IGL02605:Adgrg6 APN 10 14467232 missense probably damaging 1.00
IGL02800:Adgrg6 APN 10 14420605 missense probably damaging 1.00
IGL03175:Adgrg6 APN 10 14439758 missense probably benign 0.04
ANU05:Adgrg6 UTSW 10 14410530 missense possibly damaging 0.92
R0245:Adgrg6 UTSW 10 14458066 splice site probably benign
R0356:Adgrg6 UTSW 10 14426898 missense possibly damaging 0.47
R0388:Adgrg6 UTSW 10 14450658 missense probably benign 0.00
R0508:Adgrg6 UTSW 10 14450616 missense probably benign 0.32
R0626:Adgrg6 UTSW 10 14436884 missense probably damaging 1.00
R1116:Adgrg6 UTSW 10 14438428 missense probably benign 0.00
R1205:Adgrg6 UTSW 10 14434339 missense probably damaging 1.00
R1438:Adgrg6 UTSW 10 14468841 missense possibly damaging 0.68
R1714:Adgrg6 UTSW 10 14439770 missense possibly damaging 0.64
R1728:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1729:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R1784:Adgrg6 UTSW 10 14439782 missense probably damaging 1.00
R2124:Adgrg6 UTSW 10 14467186 missense probably damaging 0.98
R2906:Adgrg6 UTSW 10 14432950 missense probably benign 0.03
R3410:Adgrg6 UTSW 10 14440370 missense probably benign 0.10
R3982:Adgrg6 UTSW 10 14448845 missense probably benign 0.10
R4376:Adgrg6 UTSW 10 14438494 missense probably benign 0.02
R4376:Adgrg6 UTSW 10 14469050 missense probably damaging 1.00
R4445:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4446:Adgrg6 UTSW 10 14409763 missense probably damaging 1.00
R4472:Adgrg6 UTSW 10 14436781 missense probably damaging 1.00
R4622:Adgrg6 UTSW 10 14441499 missense probably damaging 1.00
R4623:Adgrg6 UTSW 10 14441499 missense probably damaging 1.00
R4649:Adgrg6 UTSW 10 14468827 missense probably damaging 1.00
R4882:Adgrg6 UTSW 10 14434337 missense possibly damaging 0.88
R4978:Adgrg6 UTSW 10 14420461 missense probably damaging 1.00
R5246:Adgrg6 UTSW 10 14426765 missense probably damaging 1.00
R5420:Adgrg6 UTSW 10 14426986 nonsense probably null
R5461:Adgrg6 UTSW 10 14420504 missense probably damaging 1.00
R5580:Adgrg6 UTSW 10 14410484 nonsense probably null
R5644:Adgrg6 UTSW 10 14432934 missense probably damaging 1.00
R5847:Adgrg6 UTSW 10 14426777 missense probably damaging 1.00
R5900:Adgrg6 UTSW 10 14438419 critical splice donor site probably null
R6302:Adgrg6 UTSW 10 14441483 missense probably benign 0.22
R6318:Adgrg6 UTSW 10 14467497 missense probably benign
R6319:Adgrg6 UTSW 10 14431622 missense probably damaging 1.00
R6339:Adgrg6 UTSW 10 14434347 missense probably damaging 1.00
R6683:Adgrg6 UTSW 10 14456167 missense probably damaging 0.97
R6983:Adgrg6 UTSW 10 14431695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTCTTACCACAGCTCAGGTTGC -3'
(R):5'- AGCTTTCTCCTACTCAGACGAGTCC -3'

Sequencing Primer
(F):5'- TGCCCTCGGCTTTCAGAG -3'
(R):5'- AGGCCAGTAATGGCTACTTC -3'
Posted On2014-04-24