Incidental Mutation 'R1599:Fam161a'
ID176053
Institutional Source Beutler Lab
Gene Symbol Fam161a
Ensembl Gene ENSMUSG00000049811
Gene Namefamily with sequence similarity 161, member A
Synonyms4930430E16Rik
MMRRC Submission 039636-MU
Accession Numbers

Genbank: NM_028672; MGI: 1921123

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location23007531-23030788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23021093 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 180 (M180L)
Ref Sequence ENSEMBL: ENSMUSP00000121167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058269] [ENSMUST00000109557] [ENSMUST00000151877] [ENSMUST00000172602] [ENSMUST00000173923]
Predicted Effect probably benign
Transcript: ENSMUST00000058269
AA Change: M424L

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000063091
Gene: ENSMUSG00000049811
AA Change: M424L

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000094363
AA Change: M208L
SMART Domains Protein: ENSMUSP00000091923
Gene: ENSMUSG00000049811
AA Change: M208L

DomainStartEndE-ValueType
Pfam:UPF0564 1 136 3.6e-15 PFAM
low complexity region 181 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109557
AA Change: M424L

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105184
Gene: ENSMUSG00000049811
AA Change: M424L

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 350 8.1e-36 PFAM
low complexity region 396 417 N/A INTRINSIC
coiled coil region 437 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151877
AA Change: M180L

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000121167
Gene: ENSMUSG00000049811
AA Change: M180L

DomainStartEndE-ValueType
Pfam:UPF0564 1 263 2.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172602
AA Change: M424L

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134485
Gene: ENSMUSG00000049811
AA Change: M424L

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Pfam:UPF0564 150 401 4.7e-74 PFAM
Pfam:UPF0564 398 451 5.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173923
SMART Domains Protein: ENSMUSP00000133293
Gene: ENSMUSG00000049811

DomainStartEndE-ValueType
coiled coil region 11 37 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 80 95 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208732
AA Change: M365L
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the FAM161 family. It is expressed mainly in the retina. Mouse studies suggested that this gene is involved in development of retinal progenitors during embryogenesis, and that its activity is restricted to mature photoreceptors after birth. Mutations in this gene cause autosomal recessive retinitis pigmentosa-28. Alternatively spliced transcript variants have been identified.[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show early loss of visual function associated with alterations in photoreceptor ciliary structure, abnormal photoreceptor outer segment morphology, microgliosis, and progressive retinal photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Fam161a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Fam161a APN 11 23015894 unclassified probably benign
IGL01457:Fam161a APN 11 23020702 nonsense probably null
IGL01823:Fam161a APN 11 23015785 missense probably damaging 1.00
IGL02111:Fam161a APN 11 23020026 missense probably benign 0.05
3-1:Fam161a UTSW 11 23023429 critical splice acceptor site probably null
R0531:Fam161a UTSW 11 23020298 missense possibly damaging 0.49
R1524:Fam161a UTSW 11 23015826 missense possibly damaging 0.80
R1550:Fam161a UTSW 11 23020470 missense possibly damaging 0.58
R3744:Fam161a UTSW 11 23020410 missense probably damaging 1.00
R3962:Fam161a UTSW 11 23023507 missense possibly damaging 0.82
R4352:Fam161a UTSW 11 23020798 missense possibly damaging 0.90
R4607:Fam161a UTSW 11 23020710 missense probably benign 0.03
R4820:Fam161a UTSW 11 23020076 missense probably damaging 1.00
R5057:Fam161a UTSW 11 23020397 missense probably damaging 1.00
R5207:Fam161a UTSW 11 23020583 nonsense probably null
R5645:Fam161a UTSW 11 23015725 missense probably damaging 1.00
R5705:Fam161a UTSW 11 23028869 missense unknown
R7107:Fam161a UTSW 11 23023452 missense possibly damaging 0.84
R7242:Fam161a UTSW 11 23020037 missense possibly damaging 0.81
R7286:Fam161a UTSW 11 23020001 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AAGAGTGTTGTCTTCACGAATCCCC -3'
(R):5'- GCCAGCAGTTTCTGCAAGTCTTTC -3'

Sequencing Primer
(F):5'- TCCCCTTGTGACTCTGATAAAAGAC -3'
(R):5'- TGCCAGTTCAGCAACCAT -3'
Posted On2014-04-24