Incidental Mutation 'R1599:Sacs'
ID176067
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission 039636-MU
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61203638 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1044 (M1044I)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119509] [ENSMUST00000119943] [ENSMUST00000227570] [ENSMUST00000229692]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119509
SMART Domains Protein: ENSMUSP00000113007
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
SCOP:d1byqa_ 87 202 5e-3 SMART
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119943
AA Change: M1044I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: M1044I

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150222
Predicted Effect probably benign
Transcript: ENSMUST00000227570
Predicted Effect probably benign
Transcript: ENSMUST00000229692
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2117:Sacs UTSW 14 61213771 missense probably benign 0.01
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAAGCTTCCAACAGATCTACGG -3'
(R):5'- CCCTTCAGAAGACTGCAAGAGTGTC -3'

Sequencing Primer
(F):5'- GATGAAGCCACCATTCGTTTG -3'
(R):5'- TCCTGATTCTGACAGGAACTGAC -3'
Posted On2014-04-24