Incidental Mutation 'R1599:Man2a1'
ID176072
Institutional Source Beutler Lab
Gene Symbol Man2a1
Ensembl Gene ENSMUSG00000024085
Gene Namemannosidase 2, alpha 1
SynonymsMana2, Map-2, Mana-2
MMRRC Submission 039636-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location64600736-64755110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64679831 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 613 (Y613H)
Ref Sequence ENSEMBL: ENSMUSP00000083928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086723
AA Change: Y613H

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000083928
Gene: ENSMUSG00000024085
AA Change: Y613H

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 45 74 N/A INTRINSIC
Pfam:Glyco_hydro_38 166 496 2.3e-111 PFAM
Alpha-mann_mid 501 587 5.39e-34 SMART
Pfam:Glyco_hydro_38C 648 1144 1.5e-98 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl hydrolase that localizes to the Golgi and catalyzes the final hydrolytic step in the asparagine-linked oligosaccharide (N-glycan) maturation pathway. Mutations in the mouse homolog of this gene have been shown to cause a systemic autoimmune disease similar to human systemic lupus erythematosus. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mutation of this gene results in premature death, dyserythropoiesis, systemic autoimmune disease, including an increase in serum immunoglobulins, glomerulonephritis, and hematuria, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Hnrnpll T A 17: 80,053,625 H118L unknown Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Man2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Man2a1 APN 17 64710705 missense probably benign 0.00
IGL01823:Man2a1 APN 17 64666824 missense probably damaging 0.99
IGL02012:Man2a1 APN 17 64666899 missense probably damaging 0.98
IGL02589:Man2a1 APN 17 64679778 missense probably benign 0.01
IGL03248:Man2a1 APN 17 64713611 missense probably damaging 1.00
R0070:Man2a1 UTSW 17 64659079 splice site probably null
R0092:Man2a1 UTSW 17 64659084 splice site probably benign
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1347:Man2a1 UTSW 17 64712450 missense probably damaging 0.98
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1376:Man2a1 UTSW 17 64672043 missense possibly damaging 0.50
R1799:Man2a1 UTSW 17 64669497 missense probably damaging 1.00
R1799:Man2a1 UTSW 17 64752457 missense probably benign 0.12
R1822:Man2a1 UTSW 17 64740842 missense probably damaging 1.00
R1958:Man2a1 UTSW 17 64750835 missense probably benign 0.00
R2852:Man2a1 UTSW 17 64713601 missense probably benign 0.00
R4324:Man2a1 UTSW 17 64666793 missense probably benign 0.00
R4582:Man2a1 UTSW 17 64752499 missense probably benign 0.00
R4610:Man2a1 UTSW 17 64712459 missense probably benign
R4803:Man2a1 UTSW 17 64659009 missense probably damaging 1.00
R5072:Man2a1 UTSW 17 64659079 splice site probably null
R5109:Man2a1 UTSW 17 64752448 missense probably benign 0.31
R5223:Man2a1 UTSW 17 64712271 missense probably benign 0.17
R5229:Man2a1 UTSW 17 64710734 missense probably benign 0.00
R5238:Man2a1 UTSW 17 64636507 missense probably damaging 1.00
R5273:Man2a1 UTSW 17 64733785 missense probably damaging 1.00
R5289:Man2a1 UTSW 17 64651227 missense probably damaging 0.99
R5352:Man2a1 UTSW 17 64731246 missense probably damaging 1.00
R5428:Man2a1 UTSW 17 64712300 missense probably benign 0.00
R5898:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5942:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5943:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5963:Man2a1 UTSW 17 64675122 missense probably benign
R5969:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R5970:Man2a1 UTSW 17 64625380 missense probably benign 0.01
R6164:Man2a1 UTSW 17 64733724 missense possibly damaging 0.87
R6207:Man2a1 UTSW 17 64713605 missense probably benign 0.02
R6245:Man2a1 UTSW 17 64710826 missense probably damaging 0.97
R6724:Man2a1 UTSW 17 64731269 missense possibly damaging 0.91
R6759:Man2a1 UTSW 17 64625388 missense probably benign 0.00
R6778:Man2a1 UTSW 17 64714635 missense possibly damaging 0.69
R7250:Man2a1 UTSW 17 64636588 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTGGCTTGTCCATTGCCTTATAAA -3'
(R):5'- AGCACCCAGAGGCTTAACAATGAGA -3'

Sequencing Primer
(F):5'- ATGCAGATCTTTGAGTTATCAAACT -3'
(R):5'- ACCTGCTTTGAGATGAATTTACTGG -3'
Posted On2014-04-24