Incidental Mutation 'R1599:Hnrnpll'
Institutional Source Beutler Lab
Gene Symbol Hnrnpll
Ensembl Gene ENSMUSG00000024095
Gene Nameheterogeneous nuclear ribonucleoprotein L-like
Synonyms2510028H02Rik, Hnrpll, 2810036L13Rik
MMRRC Submission 039636-MU
Accession Numbers

Genbank: NM_144802; MGI: 1919942

Is this an essential gene? Possibly essential (E-score: 0.527) question?
Stock #R1599 (G1)
Quality Score225
Status Not validated
Chromosomal Location80029487-80062334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80053625 bp
Amino Acid Change Histidine to Leucine at position 118 (H118L)
Ref Sequence ENSEMBL: ENSMUSP00000139372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061331] [ENSMUST00000184297] [ENSMUST00000184635]
Predicted Effect unknown
Transcript: ENSMUST00000061331
AA Change: H118L
SMART Domains Protein: ENSMUSP00000058308
Gene: ENSMUSG00000024095
AA Change: H118L

low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000184297
AA Change: H118L
SMART Domains Protein: ENSMUSP00000139075
Gene: ENSMUSG00000024095
AA Change: H118L

low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184578
Predicted Effect unknown
Transcript: ENSMUST00000184635
AA Change: H118L
SMART Domains Protein: ENSMUSP00000139372
Gene: ENSMUSG00000024095
AA Change: H118L

low complexity region 52 104 N/A INTRINSIC
RRM 126 195 2.99e-4 SMART
RRM 216 289 1.26e-2 SMART
low complexity region 314 325 N/A INTRINSIC
RRM 385 454 1.36e-7 SMART
Blast:RRM_2 504 582 3e-32 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184889
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.2%
  • 20x: 88.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HNRNPLL is a master regulator of activation-induced alternative splicing in T cells. In particular, it alters splicing of CD45 (PTPRC; MIM 151460), a tyrosine phosphatase essential for T-cell development and activation (Oberdoerffer et al., 2008 [PubMed 18669861]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a point mutation in a RNA recognition motif of the gene product have defects in the generation of alternative transcripts normally found in memory T cells. Total CD4+ T cell counts are lower, with a reduction of na�ve CD44lo T cells occurring as mice age. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,150,259 E202G probably damaging Het
9230110F15Rik T C 9: 35,839,037 N113S probably benign Het
Adam23 A G 1: 63,570,933 D698G possibly damaging Het
Adam3 T C 8: 24,725,361 D20G possibly damaging Het
Adamts12 T C 15: 11,071,711 S114P probably damaging Het
Adgrg6 T A 10: 14,467,313 R297* probably null Het
Ahdc1 A T 4: 133,064,936 S1163C possibly damaging Het
AI481877 A T 4: 59,072,349 N622K possibly damaging Het
Axl A G 7: 25,763,969 Y619H probably damaging Het
Bcl11a G T 11: 24,163,887 C410F probably damaging Het
Brca2 C A 5: 150,548,713 S2359* probably null Het
Calca A G 7: 114,634,472 S75P probably damaging Het
Ccpg1 T A 9: 72,999,125 Y54* probably null Het
Cfap161 A T 7: 83,776,079 M268K possibly damaging Het
Cfap61 T A 2: 146,012,163 V365E probably benign Het
Cgnl1 T C 9: 71,641,427 I1000V probably benign Het
Chd2 A T 7: 73,473,051 D978E probably benign Het
Ctgf A T 10: 24,597,399 R279W probably benign Het
Cyth1 G A 11: 118,177,221 T297M probably damaging Het
Dennd1b T G 1: 139,167,730 D505E probably benign Het
Dgkd A G 1: 87,881,886 T99A possibly damaging Het
Fam161a A T 11: 23,021,093 M180L probably benign Het
Gar1 G T 3: 129,830,604 R80S probably benign Het
Gm28042 T C 2: 120,036,463 S419P probably benign Het
Gm5591 A C 7: 38,520,370 C360G probably benign Het
Golga2 A G 2: 32,303,173 H427R probably benign Het
Gpt2 A G 8: 85,512,234 Y232C probably damaging Het
Ice2 T A 9: 69,411,442 C303S probably null Het
Ikzf3 C A 11: 98,467,093 G473C probably damaging Het
Kansl3 A T 1: 36,367,870 D38E probably damaging Het
Kcna6 A T 6: 126,739,319 D202E probably benign Het
Klhl21 G A 4: 152,012,300 G341D probably damaging Het
Klhl29 A T 12: 5,093,538 V497D probably damaging Het
Kmt2b G A 7: 30,570,575 L2449F probably damaging Het
Kmt5c A G 7: 4,741,900 E10G probably damaging Het
Lama3 C T 18: 12,450,400 Q682* probably null Het
Lamb3 T C 1: 193,320,493 V82A probably damaging Het
Larp4b C T 13: 9,122,150 T2I probably damaging Het
Man2a1 T C 17: 64,679,831 Y613H possibly damaging Het
Mcm3 G A 1: 20,820,198 T4I probably benign Het
Mki67 C T 7: 135,699,934 A1124T probably benign Het
Mlh3 A T 12: 85,268,369 L348I probably damaging Het
Mmrn1 G A 6: 60,945,037 M159I probably benign Het
Muc5ac A T 7: 141,798,903 Q709L possibly damaging Het
Naip2 C T 13: 100,161,981 A516T possibly damaging Het
Nosip A G 7: 45,074,006 N32S probably benign Het
Npat T C 9: 53,562,404 Y499H possibly damaging Het
Nt5c1b T A 12: 10,390,024 I522N probably damaging Het
Olfr347 G T 2: 36,734,989 V223F probably benign Het
Olfr457 T A 6: 42,471,242 K312M probably damaging Het
Olfr653 A G 7: 104,579,648 M1V probably null Het
Olfr850 T A 9: 19,478,221 T7S probably damaging Het
Pappa2 A G 1: 158,857,172 F799S probably damaging Het
Pcdha1 C T 18: 37,185,237 T941M probably damaging Het
Pilrb2 A T 5: 137,868,597 F215I possibly damaging Het
Pkd1l3 G T 8: 109,636,384 M1092I probably benign Het
Ppp1r21 G T 17: 88,572,627 V491L probably benign Het
Prickle2 T C 6: 92,410,874 T516A probably benign Het
Prr27 G T 5: 87,843,225 R232L probably benign Het
Rab3gap2 C T 1: 185,251,026 T454I probably benign Het
Rgs11 C A 17: 26,208,249 H385N probably damaging Het
S1pr5 T A 9: 21,243,934 T399S probably benign Het
Sacs G A 14: 61,203,638 M1044I probably benign Het
Sec31b T A 19: 44,523,153 Q603L possibly damaging Het
Setx G A 2: 29,140,373 E275K probably benign Het
Sh3tc1 G A 5: 35,707,512 P444S probably benign Het
Strn3 T A 12: 51,652,766 N208Y possibly damaging Het
Tmem87a T C 2: 120,394,387 N131S probably damaging Het
Tmprss13 T A 9: 45,338,318 W318R probably damaging Het
Trabd2b T C 4: 114,408,981 V64A probably damaging Het
Trafd1 A T 5: 121,379,657 N24K probably damaging Het
Ttc41 T C 10: 86,776,573 S1237P probably benign Het
Ttll1 A G 15: 83,497,354 V238A probably benign Het
Vps50 T C 6: 3,565,537 S492P probably benign Het
Zic1 T C 9: 91,361,688 I409V probably benign Het
Other mutations in Hnrnpll
AlleleSourceChrCoordTypePredicted EffectPPH Score
thunder APN 17 80053571 missense probably damaging 1.00
IGL01989:Hnrnpll APN 17 80038740 missense probably benign 0.15
IGL02093:Hnrnpll APN 17 80044504 missense probably benign 0.00
IGL02141:Hnrnpll APN 17 80050713 missense probably benign 0.02
IGL02749:Hnrnpll APN 17 80061991 start codon destroyed probably null
IGL03213:Hnrnpll APN 17 80034098 missense probably damaging 1.00
R0477:Hnrnpll UTSW 17 80061832 missense unknown
R1700:Hnrnpll UTSW 17 80034105 missense probably benign 0.18
R1838:Hnrnpll UTSW 17 80038623 missense probably damaging 1.00
R1907:Hnrnpll UTSW 17 80035329 critical splice donor site probably null
R1978:Hnrnpll UTSW 17 80044518 missense probably benign 0.01
R2079:Hnrnpll UTSW 17 80035377 missense probably benign 0.01
R4061:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4062:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4064:Hnrnpll UTSW 17 80032772 missense probably benign 0.01
R4226:Hnrnpll UTSW 17 80049805 critical splice donor site probably null
R4625:Hnrnpll UTSW 17 80050862 nonsense probably null
R5175:Hnrnpll UTSW 17 80034070 missense possibly damaging 0.83
R5232:Hnrnpll UTSW 17 80038678 missense probably damaging 1.00
R5620:Hnrnpll UTSW 17 80038622 missense probably damaging 1.00
R5978:Hnrnpll UTSW 17 80034191 missense probably damaging 1.00
R6183:Hnrnpll UTSW 17 80049876 missense possibly damaging 0.46
R6374:Hnrnpll UTSW 17 80049874 missense possibly damaging 0.51
R7120:Hnrnpll UTSW 17 80034057 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- agaaaccctgccttgaaaaac -3'
Posted On2014-04-24