Incidental Mutation 'R1600:Zswim9'
ID176089
Institutional Source Beutler Lab
Gene Symbol Zswim9
Ensembl Gene ENSMUSG00000070814
Gene Namezinc finger SWIM-type containing 9
Synonyms6330408A02Rik
MMRRC Submission 039637-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R1600 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13258967-13278721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13269571 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 118 (C118R)
Ref Sequence ENSEMBL: ENSMUSP00000112825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108532] [ENSMUST00000119139] [ENSMUST00000119558]
Predicted Effect probably damaging
Transcript: ENSMUST00000108532
AA Change: C118R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104172
Gene: ENSMUSG00000070814
AA Change: C118R

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119139
AA Change: C118R

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112652
Gene: ENSMUSG00000070814
AA Change: C118R

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
low complexity region 405 423 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119558
AA Change: C118R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140530
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 85% (41/48)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acin1 T C 14: 54,643,717 probably benign Het
Acot3 C T 12: 84,058,710 A317V probably benign Het
Ahrr T C 13: 74,214,378 D334G probably benign Het
Alpk2 C T 18: 65,378,037 V30M probably damaging Het
Arhgef25 G T 10: 127,185,289 H281N probably damaging Het
B3gntl1 A G 11: 121,630,836 M175T probably damaging Het
BC080695 A G 4: 143,571,967 E160G possibly damaging Het
Brca2 T A 5: 150,560,830 probably benign Het
Ccnj A T 19: 40,844,657 probably benign Het
Cebpzos A G 17: 78,918,388 K11E probably damaging Het
Col6a6 A G 9: 105,778,075 S816P probably damaging Het
Cul4a A G 8: 13,123,954 R64G probably damaging Het
Cul7 C A 17: 46,651,822 C126* probably null Het
Ercc2 T C 7: 19,385,941 Y176H probably benign Het
Frem2 T G 3: 53,547,723 D2144A probably damaging Het
Gabrg3 A T 7: 56,735,074 Y246* probably null Het
Gm21731 T C 13: 120,240,833 V55A probably benign Het
Gpatch2l T C 12: 86,256,934 probably null Het
Grk1 A G 8: 13,405,406 T97A probably benign Het
Hmcn2 A G 2: 31,430,787 E4004G probably damaging Het
Kcnu1 A T 8: 25,849,793 R46S probably damaging Het
Lrrfip1 T C 1: 91,114,667 S265P probably damaging Het
Lyve1 A G 7: 110,853,695 probably null Het
Mme A G 3: 63,365,058 Y659C probably damaging Het
Mrs2 G T 13: 24,995,410 N299K possibly damaging Het
Mtnr1b T C 9: 15,863,319 Y148C probably damaging Het
Myo5b T A 18: 74,713,540 probably benign Het
Neb A G 2: 52,271,604 Y2059H probably damaging Het
Nkain3 T C 4: 20,469,528 probably benign Het
Peg10 A T 6: 4,757,080 probably benign Het
Rufy2 A G 10: 63,006,671 T458A probably benign Het
Sec14l1 G A 11: 117,150,604 V448I probably benign Het
Tbx19 C T 1: 165,142,567 G251D possibly damaging Het
Trappc9 G A 15: 72,937,109 Q711* probably null Het
Trpm3 A G 19: 22,139,155 R13G probably benign Het
Usp33 G T 3: 152,379,610 A628S probably damaging Het
Vps13a T C 19: 16,666,272 N2080S probably benign Het
Wdr45b A T 11: 121,330,189 I221N probably damaging Het
Zfp119a A T 17: 55,868,355 W47R possibly damaging Het
Other mutations in Zswim9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01926:Zswim9 APN 7 13260321 missense possibly damaging 0.53
IGL02063:Zswim9 APN 7 13260681 missense probably damaging 0.98
R0568:Zswim9 UTSW 7 13261026 missense probably damaging 0.99
R0680:Zswim9 UTSW 7 13260321 missense probably benign 0.10
R1438:Zswim9 UTSW 7 13277218 missense possibly damaging 0.86
R1678:Zswim9 UTSW 7 13277411 missense probably benign 0.04
R1745:Zswim9 UTSW 7 13269556 missense probably damaging 1.00
R1938:Zswim9 UTSW 7 13260214 nonsense probably null
R2025:Zswim9 UTSW 7 13269366 missense probably damaging 0.98
R3149:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3150:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3176:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3177:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3276:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3277:Zswim9 UTSW 7 13277270 missense possibly damaging 0.94
R3950:Zswim9 UTSW 7 13261577 missense possibly damaging 0.95
R4554:Zswim9 UTSW 7 13277162 missense probably benign 0.33
R4866:Zswim9 UTSW 7 13261169 missense probably damaging 0.99
R4953:Zswim9 UTSW 7 13269558 missense probably damaging 1.00
R5330:Zswim9 UTSW 7 13259985 missense probably damaging 1.00
R5394:Zswim9 UTSW 7 13260983 missense probably damaging 1.00
R5408:Zswim9 UTSW 7 13260826 missense possibly damaging 0.66
R5654:Zswim9 UTSW 7 13261168 missense probably damaging 0.99
R5810:Zswim9 UTSW 7 13260735 missense probably damaging 0.98
R5859:Zswim9 UTSW 7 13261445 missense probably damaging 0.99
R6235:Zswim9 UTSW 7 13261603 missense probably damaging 1.00
R6239:Zswim9 UTSW 7 13261331 nonsense probably null
R6249:Zswim9 UTSW 7 13260977 missense probably damaging 0.98
R6394:Zswim9 UTSW 7 13260963 missense probably damaging 0.99
R7077:Zswim9 UTSW 7 13259752 missense probably damaging 1.00
R7133:Zswim9 UTSW 7 13259737 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCTACTTGTGAGACCCTACCTTGG -3'
(R):5'- ACAAAGGTGTGTGGTCATTTGGGAC -3'

Sequencing Primer
(F):5'- TTGCAGGGCATCTAGGACC -3'
(R):5'- tttaccatacagagatgaaatgcag -3'
Posted On2014-04-24