Incidental Mutation 'R1601:Thrap3'
ID176136
Institutional Source Beutler Lab
Gene Symbol Thrap3
Ensembl Gene ENSMUSG00000043962
Gene Namethyroid hormone receptor associated protein 3
Synonyms9330151F09Rik, B230333E16Rik, Trap150
MMRRC Submission 039638-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R1601 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126164082-126202760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 126180101 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 284 (G284A)
Ref Sequence ENSEMBL: ENSMUSP00000101748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080919] [ENSMUST00000106142] [ENSMUST00000123008] [ENSMUST00000136157] [ENSMUST00000163306] [ENSMUST00000169403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080919
AA Change: G284A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079722
Gene: ENSMUSG00000043962
AA Change: G284A

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
low complexity region 77 95 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 123 788 1.9e-207 PFAM
low complexity region 790 801 N/A INTRINSIC
low complexity region 835 854 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106142
AA Change: G284A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101748
Gene: ENSMUSG00000043962
AA Change: G284A

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
low complexity region 77 95 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
Pfam:THRAP3_BCLAF1 123 709 8.7e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123008
SMART Domains Protein: ENSMUSP00000131956
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136157
SMART Domains Protein: ENSMUSP00000120140
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151728
Predicted Effect probably benign
Transcript: ENSMUST00000163306
SMART Domains Protein: ENSMUSP00000126399
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 49 136 1.2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163459
SMART Domains Protein: ENSMUSP00000129775
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
Pfam:THRAP3_BCLAF1 1 39 4e-17 PFAM
low complexity region 41 58 N/A INTRINSIC
low complexity region 59 77 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
Pfam:Btz 124 192 3.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169403
SMART Domains Protein: ENSMUSP00000125856
Gene: ENSMUSG00000043962

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169855
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
4933416C03Rik T C 10: 116,113,616 S2G probably damaging Het
Adgra2 T C 8: 27,110,018 probably null Het
Adgrb2 T C 4: 129,992,837 S257P probably benign Het
Adgre1 A G 17: 57,441,353 K518E probably benign Het
Anxa7 A T 14: 20,464,615 Y64* probably null Het
Arhgef7 A G 8: 11,782,638 probably null Het
Cdc42bpa T A 1: 180,065,001 Y243* probably null Het
Cdk14 C T 5: 5,135,378 V176M probably damaging Het
Cnbd2 A G 2: 156,333,631 E54G probably damaging Het
Crx T C 7: 15,867,811 probably null Het
Cyp24a1 A G 2: 170,485,691 F511L possibly damaging Het
Ddx11 A G 17: 66,150,385 M810V probably damaging Het
Dock10 T C 1: 80,549,802 T1077A probably benign Het
Dopey1 G A 9: 86,536,250 D2011N probably damaging Het
Ehhadh T A 16: 21,766,408 H241L probably benign Het
Enah A T 1: 181,919,620 L523* probably null Het
Fabp3 T C 4: 130,308,848 L24P probably benign Het
Fat2 A G 11: 55,282,010 S2626P probably benign Het
Fbxo4 A G 15: 3,968,965 M337T possibly damaging Het
Gas6 G T 8: 13,465,786 T662N probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Hrh4 G A 18: 13,015,898 V106I possibly damaging Het
Ido2 G T 8: 24,576,189 H20Q possibly damaging Het
Ikbkap T A 4: 56,774,756 K740* probably null Het
Itga10 G T 3: 96,653,658 R613L possibly damaging Het
Itsn2 T C 12: 4,658,452 S836P probably benign Het
Kcng3 A T 17: 83,588,339 C233S probably damaging Het
Kdm3b A G 18: 34,808,731 Q625R probably damaging Het
Kidins220 A G 12: 25,005,088 S553G probably benign Het
Krt82 A T 15: 101,545,153 I266N probably damaging Het
Lama5 A T 2: 180,197,745 L736Q probably damaging Het
Lnx2 A G 5: 147,033,519 C138R probably damaging Het
Mcm5 T C 8: 75,119,354 C397R possibly damaging Het
Me1 A C 9: 86,678,012 Y52D probably damaging Het
Muc4 C A 16: 32,755,501 probably benign Het
Myo18b G T 5: 112,871,498 Q638K possibly damaging Het
Ncapd2 A G 6: 125,185,772 L170P probably damaging Het
Neb A T 2: 52,287,252 L1359* probably null Het
Nomo1 C A 7: 46,046,955 S299Y probably damaging Het
Olfr1359 C A 13: 21,703,226 T75K probably damaging Het
Olfr1509 A C 14: 52,450,442 T10P probably benign Het
Olfr322 A T 11: 58,666,077 R173W probably damaging Het
Olfr57 A T 10: 79,035,504 Y236F possibly damaging Het
Onecut1 A T 9: 74,862,691 H132L probably benign Het
Paqr3 A G 5: 97,111,389 Y19H probably benign Het
Prdx5 T C 19: 6,907,558 H140R possibly damaging Het
Prox1 T C 1: 190,161,006 D414G probably damaging Het
Ptprh T G 7: 4,552,638 E774A probably damaging Het
Rnpepl1 A T 1: 92,917,222 D412V possibly damaging Het
Sars2 C T 7: 28,748,971 T259M probably benign Het
Sbf2 T C 7: 110,340,076 probably null Het
Sbno2 C T 10: 80,060,492 R898H probably damaging Het
Smox C A 2: 131,520,174 T172N probably damaging Het
Tdrd9 C T 12: 112,023,253 R341* probably null Het
Tmtc4 A G 14: 122,944,826 V271A probably benign Het
Trank1 A G 9: 111,373,477 T1637A probably damaging Het
Tspan5 T A 3: 138,896,835 I166N probably damaging Het
Vps13b T C 15: 35,642,436 V1398A probably benign Het
Xbp1 C T 11: 5,521,975 R34W probably damaging Het
Other mutations in Thrap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00654:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00763:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00907:Thrap3 APN 4 126165578 missense probably benign 0.01
IGL00990:Thrap3 APN 4 126165395 unclassified probably benign
IGL01722:Thrap3 APN 4 126165529 missense possibly damaging 0.87
IGL02487:Thrap3 APN 4 126167001 missense possibly damaging 0.93
IGL02802:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02837:Thrap3 UTSW 4 126165364 unclassified probably benign
IGL02988:Thrap3 UTSW 4 126165542 splice site probably null
IGL03050:Thrap3 UTSW 4 126165542 splice site probably null
IGL03055:Thrap3 UTSW 4 126165542 splice site probably null
R0585:Thrap3 UTSW 4 126178574 unclassified probably null
R1023:Thrap3 UTSW 4 126180089 missense possibly damaging 0.73
R1237:Thrap3 UTSW 4 126180069 missense probably benign 0.02
R1445:Thrap3 UTSW 4 126176336 missense probably damaging 1.00
R2058:Thrap3 UTSW 4 126180174 missense probably damaging 1.00
R2063:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2064:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2065:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2066:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2067:Thrap3 UTSW 4 126175396 missense possibly damaging 0.57
R2098:Thrap3 UTSW 4 126180030 missense probably damaging 1.00
R3791:Thrap3 UTSW 4 126167500 missense possibly damaging 0.76
R4052:Thrap3 UTSW 4 126176219 missense probably damaging 1.00
R4097:Thrap3 UTSW 4 126171802 missense probably damaging 1.00
R4153:Thrap3 UTSW 4 126173442 critical splice donor site probably null
R4399:Thrap3 UTSW 4 126167079 splice site probably benign
R5265:Thrap3 UTSW 4 126167640 missense probably damaging 1.00
R5687:Thrap3 UTSW 4 126180486 unclassified probably benign
R5993:Thrap3 UTSW 4 126175460 unclassified probably null
R6305:Thrap3 UTSW 4 126180807 unclassified probably benign
R6917:Thrap3 UTSW 4 126180492 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAGATGAGCCATATGCAGAGCC -3'
(R):5'- CCACAGCAGAGTTGAGTCGTCTAAG -3'

Sequencing Primer
(F):5'- CCAGTAGCTGGTGGACTCTTAC -3'
(R):5'- TGAGTCGTCTAAGCGAAAGTCTAC -3'
Posted On2014-04-24