Incidental Mutation 'R1603:4931408C20Rik'
ID176232
Institutional Source Beutler Lab
Gene Symbol 4931408C20Rik
Ensembl Gene ENSMUSG00000073722
Gene NameRIKEN cDNA 4931408C20 gene
Synonyms
MMRRC Submission 039640-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1603 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location26681814-26687460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26685569 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 177 (R177W)
Ref Sequence ENSEMBL: ENSMUSP00000095410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097801]
Predicted Effect probably damaging
Transcript: ENSMUST00000097801
AA Change: R177W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095410
Gene: ENSMUSG00000073722
AA Change: R177W

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:FAM75 128 474 4.6e-28 PFAM
internal_repeat_1 939 1112 4.27e-16 PROSPERO
internal_repeat_1 1204 1376 4.27e-16 PROSPERO
Meta Mutation Damage Score 0.0248 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.4%
  • 20x: 89.3%
Validation Efficiency 96% (65/68)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,870,213 S169N probably benign Het
Ace T A 11: 105,972,099 S315R probably benign Het
Adamtsl1 A G 4: 86,415,530 I1491V probably benign Het
Adrb2 A T 18: 62,179,508 M82K probably damaging Het
Aebp2 A G 6: 140,642,253 N350D probably damaging Het
Ankrd42 T C 7: 92,619,691 probably benign Het
Asap1 A T 15: 64,129,257 C492S probably damaging Het
Atp8b3 C A 10: 80,525,785 A768S probably benign Het
Chga T A 12: 102,564,607 probably null Het
Clca4b A G 3: 144,922,019 V397A probably benign Het
Cntnap5a A C 1: 116,412,101 T697P possibly damaging Het
Col12a1 T C 9: 79,612,962 Q2810R probably damaging Het
Dchs1 G T 7: 105,762,770 R1380S probably benign Het
Dgkg T A 16: 22,570,159 probably benign Het
Dlgap3 G A 4: 127,195,228 G206R probably damaging Het
Dnah5 A G 15: 28,294,985 probably benign Het
Dnah5 A T 15: 28,449,180 I4243L probably benign Het
Fbxw22 G T 9: 109,378,847 P452H probably benign Het
Fgl1 T A 8: 41,197,018 D242V probably damaging Het
Gba2 C T 4: 43,567,823 G794R probably damaging Het
Gimap7 A T 6: 48,723,930 D150V probably damaging Het
Gm5334 T C 7: 68,618,872 V13A probably benign Het
Gm6803 C A 12: 88,018,364 E136D probably benign Het
Grk5 T C 19: 61,069,362 F167L probably benign Het
Ice1 A G 13: 70,603,353 L1538P probably benign Het
Idh2 T G 7: 80,099,158 E125A probably damaging Het
Kmt2a A T 9: 44,841,561 probably null Het
Kras A T 6: 145,225,145 L168* probably null Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Mak T C 13: 41,042,106 D377G possibly damaging Het
Matn2 T C 15: 34,388,768 C335R probably damaging Het
Mcoln2 C T 3: 146,180,222 S276F probably damaging Het
Morc3 C A 16: 93,866,503 N531K probably benign Het
Obp2a G A 2: 25,702,745 S175N probably benign Het
Olfr1437 A T 19: 12,321,984 V281E probably damaging Het
Olfr319 T C 11: 58,702,460 V253A probably benign Het
Olfr733 T G 14: 50,299,034 I92L possibly damaging Het
Osbpl3 C A 6: 50,323,093 K510N probably damaging Het
Papd4 G A 13: 93,175,565 A209V probably benign Het
Pcnx2 G A 8: 125,839,626 S1026F probably damaging Het
Pom121l2 A T 13: 21,983,344 D595V probably damaging Het
Poteg T A 8: 27,448,005 M1K probably null Het
Rbl1 G A 2: 157,175,659 L547F possibly damaging Het
Rpap3 T C 15: 97,701,121 T82A possibly damaging Het
Sema7a G A 9: 57,960,676 D512N probably benign Het
Sgpl1 C T 10: 61,105,451 V294M possibly damaging Het
Slc22a28 A G 19: 8,063,309 S526P probably damaging Het
Trim30b T G 7: 104,365,812 Q123P possibly damaging Het
Trpm5 A G 7: 143,085,209 L275P probably benign Het
Ttc33 A G 15: 5,189,794 E71G probably damaging Het
Unc13d T C 11: 116,073,655 T288A possibly damaging Het
Unc93a T A 17: 13,109,634 E444V probably benign Het
Usf3 T A 16: 44,218,172 M1005K probably benign Het
Vmn2r91 T C 17: 18,106,143 I230T probably benign Het
Wdr49 G A 3: 75,396,870 Q448* probably null Het
Zfp939 T A 7: 39,473,271 noncoding transcript Het
Other mutations in 4931408C20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:4931408C20Rik APN 1 26684977 missense probably benign 0.00
IGL00575:4931408C20Rik APN 1 26682932 missense possibly damaging 0.51
IGL00656:4931408C20Rik APN 1 26682901 missense possibly damaging 0.71
IGL00671:4931408C20Rik APN 1 26684859 missense possibly damaging 0.50
IGL00777:4931408C20Rik APN 1 26682092 missense probably damaging 1.00
IGL00824:4931408C20Rik APN 1 26683589 missense possibly damaging 0.48
IGL01018:4931408C20Rik APN 1 26682910 missense probably damaging 0.99
IGL01148:4931408C20Rik APN 1 26685172 missense probably benign 0.22
IGL01631:4931408C20Rik APN 1 26685414 missense probably damaging 0.98
IGL01901:4931408C20Rik APN 1 26682584 missense probably benign 0.13
IGL01957:4931408C20Rik APN 1 26685259 missense probably damaging 0.98
IGL02031:4931408C20Rik APN 1 26685023 missense probably damaging 0.99
IGL02596:4931408C20Rik APN 1 26684002 missense probably benign 0.00
PIT4486001:4931408C20Rik UTSW 1 26685329 missense probably damaging 0.99
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0043:4931408C20Rik UTSW 1 26683802 missense possibly damaging 0.72
R0141:4931408C20Rik UTSW 1 26683782 missense probably benign 0.00
R0145:4931408C20Rik UTSW 1 26687332 missense probably benign 0.00
R0158:4931408C20Rik UTSW 1 26683951 missense probably damaging 0.98
R0325:4931408C20Rik UTSW 1 26685266 missense possibly damaging 0.91
R0627:4931408C20Rik UTSW 1 26685889 missense probably benign 0.00
R0733:4931408C20Rik UTSW 1 26682932 missense possibly damaging 0.51
R1033:4931408C20Rik UTSW 1 26682385 missense probably benign
R1074:4931408C20Rik UTSW 1 26683226 missense probably benign 0.00
R1108:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1139:4931408C20Rik UTSW 1 26682665 missense probably benign 0.04
R1326:4931408C20Rik UTSW 1 26683930 missense probably damaging 1.00
R1398:4931408C20Rik UTSW 1 26685341 missense possibly damaging 0.82
R1422:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1463:4931408C20Rik UTSW 1 26682141 nonsense probably null
R1485:4931408C20Rik UTSW 1 26685880 missense possibly damaging 0.92
R1568:4931408C20Rik UTSW 1 26685869 missense probably benign 0.01
R1605:4931408C20Rik UTSW 1 26684430 missense possibly damaging 0.92
R1795:4931408C20Rik UTSW 1 26682989 nonsense probably null
R1945:4931408C20Rik UTSW 1 26682314 missense probably benign 0.04
R1967:4931408C20Rik UTSW 1 26683373 missense probably benign 0.02
R2055:4931408C20Rik UTSW 1 26685732 missense possibly damaging 0.86
R2093:4931408C20Rik UTSW 1 26682141 nonsense probably null
R2131:4931408C20Rik UTSW 1 26685854 missense probably benign 0.11
R2237:4931408C20Rik UTSW 1 26685160 missense possibly damaging 0.82
R2314:4931408C20Rik UTSW 1 26684702 missense probably benign 0.00
R2407:4931408C20Rik UTSW 1 26682838 missense possibly damaging 0.86
R2993:4931408C20Rik UTSW 1 26685828 missense possibly damaging 0.83
R4245:4931408C20Rik UTSW 1 26682080 missense probably benign 0.00
R4567:4931408C20Rik UTSW 1 26683117 missense probably benign
R4605:4931408C20Rik UTSW 1 26683186 missense probably benign 0.45
R4708:4931408C20Rik UTSW 1 26684440 missense possibly damaging 0.92
R4827:4931408C20Rik UTSW 1 26685842 missense possibly damaging 0.91
R4839:4931408C20Rik UTSW 1 26685359 missense probably benign 0.11
R4888:4931408C20Rik UTSW 1 26683547 missense probably benign 0.00
R5075:4931408C20Rik UTSW 1 26683052 missense probably damaging 0.99
R5101:4931408C20Rik UTSW 1 26683336 missense possibly damaging 0.92
R5231:4931408C20Rik UTSW 1 26683951 missense possibly damaging 0.79
R5310:4931408C20Rik UTSW 1 26685088 missense probably benign 0.00
R5459:4931408C20Rik UTSW 1 26685191 missense probably damaging 0.96
R5520:4931408C20Rik UTSW 1 26685819 missense probably benign 0.00
R5608:4931408C20Rik UTSW 1 26683048 missense probably damaging 0.97
R5960:4931408C20Rik UTSW 1 26683144 missense probably benign 0.34
R6128:4931408C20Rik UTSW 1 26685425 missense probably benign 0.38
R6188:4931408C20Rik UTSW 1 26685703 missense probably damaging 0.99
R6319:4931408C20Rik UTSW 1 26685401 missense probably benign 0.38
R6339:4931408C20Rik UTSW 1 26682505 missense probably benign 0.01
R6431:4931408C20Rik UTSW 1 26684030 missense probably benign 0.11
R6456:4931408C20Rik UTSW 1 26685169 missense probably damaging 0.99
R6562:4931408C20Rik UTSW 1 26682362 missense possibly damaging 0.91
R6645:4931408C20Rik UTSW 1 26683117 missense probably benign 0.06
R6647:4931408C20Rik UTSW 1 26682578 missense probably damaging 0.99
R6919:4931408C20Rik UTSW 1 26682934 missense probably benign 0.15
R7085:4931408C20Rik UTSW 1 26683465 missense possibly damaging 0.95
X0025:4931408C20Rik UTSW 1 26682505 missense probably benign 0.00
X0061:4931408C20Rik UTSW 1 26682569 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGGCTCTTCTCTGGGATGAAGGAC -3'
(R):5'- GCTGCCAAAAGAATTCGCAGGATAC -3'

Sequencing Primer
(F):5'- CTGGGATGAAGGACGTGATTG -3'
(R):5'- GGAAAGGCCCATTCATTGTC -3'
Posted On2014-04-24